Previous research, primarily amongst populations with excessive consumption of seafood, have advised that elevated marine n-3 polyunsaturated fatty acid (PUFA) intake throughout pregnancy promotes longer gestation and increased start weight. Few research have remoted the contribution of fetal growth to start weight. Using information from 2,109 pregnant girls in Massachusetts enrolled in Project Viva from 1999 to 2002, the authors examined associations of marine n-3 PUFA and seafood intake with start weight and birth-weight-for-gestational-age z worth (fetal growth) utilizing linear regression; length of gestation utilizing median regression; and low start weight, preterm supply, and being small for gestational age utilizing logistic regression.
After adjustment for maternal and baby components, start weight was 94 (95% confidence interval: 23, 166) g decrease and fetal growth z worth 0.19 (95% confidence interval: 0.08, 0.31) items decrease within the highest in contrast with the bottom quartile of first-trimester n-3 PUFA intake. Results for the second and third trimesters have been comparable, and findings for seafood paralleled these for n-3 PUFA. Elongated n-3 PUFA intake and seafood intake weren’t related with length of gestation or threat of preterm start. Results from this US cohort assist the conclusion that seafood intake throughout pregnancy is related with diminished fetal growth.
Lifetime prevalence charges in numerous international locations for bipolar I dysfunction, bipolar II dysfunction, bipolar spectrum dysfunction, and schizophrenia have been recognized from population-based epidemiological research that used comparable strategies. These epidemiological research used structured diagnostic interviews with comparable diagnostic standards and have been inhabitants based mostly with giant pattern sizes. Simple linear and nonlinear regression analyses have been used to check these prevalence information to variations in obvious seafood consumption, an financial measure of disappearance of seafood from the economic system.

Investigation of archaeal and bacterial range in fermented seafood utilizing barcoded pyrosequencing.

Little is understood concerning the archaeal range of fermented seafood; most of the sooner research of fermented meals have targeted on lactic acid micro organism (LAB) within the fermentation course of. In this examine, the archaeal and bacterial range in seven sorts of fermented seafood have been culture-independently examined utilizing barcoded pyrosequencing and PCR-denaturing gradient gel electrophoresis (DGGE) strategies. The multiplex barcoded pyrosequencing was carried out in a single run, with a number of samples tagged uniquely by multiplex identifiers, utilizing completely different primers for Archaea or Bacteria. Because PCR-DGGE evaluation is a standard molecular ecological strategy, this evaluation was additionally carried out on the identical samples and the results have been in contrast with the results of the barcoded pyrosequencing evaluation.
A complete of 13 372 sequences have been retrieved from 15 898 pyrosequencing reads and have been analyzed to judge the variety of the archaeal and bacterial populations in seafood. The most predominant sorts of archaea and micro organism recognized within the samples included extraordinarily halophilic archaea associated to the household Halobacteriaceae; numerous uncultured mesophilic Crenarchaeota, together with Crenarchaeota Group I.1 (CG I.1a and CG I.1b), Marine Benthic Group B (MBG-B), and Miscellaneous Crenarchaeotic Group (MCG); and LAB affiliated with genus Lactobacillus and Weissella.
Interestingly, quite a few uncultured mesophilic Crenarchaeota teams have been as ubiquitous within the fermented seafood as in terrestrial and aquatic niches; the existence of these Crenarchaeota teams has not been reported in any fermented meals. These results point out that the archaeal populations within the fermented seafood analyzed are numerous and embody the halophilic and mesophilic teams, and that barcoded pyrosequencing is a promising and cost-effective technique for analyzing microbial range in contrast with standard approaches.
 Associations of seafood and elongated n-3 fatty acid intake with fetal growth and length of gestation: results from a US pregnancy cohort.

Epidemiology of seafood-associated infections within the United States.

Seafood is a component of a healthful food plan, however seafood consumption just isn’t risk-free. Seafood is accountable for an vital proportion of food-borne diseases and outbreaks within the United States. Seafood-associated infections are brought on by a selection of micro organism, viruses, and parasites; this numerous group of pathogens results in a wide selection of medical syndromes, every with its personal epidemiology. Some seafood commodities are inherently extra dangerous than others, owing to many components, together with the character of the atmosphere from which they arrive, their mode of feeding, the season throughout which they’re harvested, and how they’re ready and served.

Prevention of seafood-associated infections requires an understanding not solely of the etiologic brokers and seafood commodities related with sickness but additionally of the mechanisms of contamination which are amenable to manage. Defining these drawback areas, which depends on surveillance of seafood-associated infections by means of outbreak and case reporting, can result in focused analysis and assist to information management efforts. Coordinated efforts are essential to additional scale back the danger of seafood-associated diseases. Continued surveillance can be vital to evaluate the effectiveness of present and future prevention methods.

T&A Cloning Vector

FYC002-20P 1 vial Ask for price

dCas9 C-terminal Cloning Vector

K014 10 ug
EUR 721

pUCM-T Cloning Vector Kit

BS435 20Preps
EUR 93.5
  • Product category: Molecular Biology Kits/Cloning/Cloning Kits (Specific)

pUCM-T Cloning Vector Kit

BS436 100preps
EUR 224
  • Product category: Molecular Biology Kits/Cloning/Cloning Kits (Specific)

gRNA- Cloning

PVT10957 2 ug
EUR 301

pcDNA3 GFP LIC cloning vector (6D)

PVT10748 2 ug
EUR 301

PUCM-T Cloning Vector (50ng/ul)

BS433 1UG
EUR 76.1
  • Product category: PCR Related/Vectors/Plasmids

PUCM-T Cloning Vector (50ng/ul)

BS434 5UG
EUR 154.4
  • Product category: PCR Related/Vectors/Plasmids

pCDF1-MCS1 cDNA Cloning and Expression Vector

CD100A-1 10 ug
EUR 544
  • Category: Lentiviral Technology

CPSF3 cloning plasmid

CSB-CL890734HU-10ug 10ug
EUR 685
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2055
  • Sequence: atgtctgcgattcctgctgaggagagcgaccagctgctgatccgaccccttggagctgggcaagaagtaggaagatcatgtattattctcgagttcaaaggaagaaaaataatgctcgactgtgggatccaccctggcctagaaggaatggatgctcttccttatattgatttaa
  • Show more
Description: A cloning plasmid for the CPSF3 gene.

PILRB cloning plasmid

CSB-CL890735HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgggtcggcccctgctgctgcccctgctgctcctgctgcagccgccagcatttctgcagcctggtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctg
  • Show more
Description: A cloning plasmid for the PILRB gene.

NXT1 cloning plasmid

CSB-CL890736HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atggcatctgtggatttcaagacctatgtggatcaggcctgcagagctgctgaggagtttgtcaatgtctactacaccaccatggataagcggcggcgtttgctgtcccgcctgtacatgggcacagccaccctggtctggaatggcaatgctgtttcaggacaagaatccttgag
  • Show more
Description: A cloning plasmid for the NXT1 gene.

FBXL3 cloning plasmid

CSB-CL890739HU-10ug 10ug
EUR 469
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1287
  • Sequence: atgaaacgaggaggaagagatagtgaccgtaattcatcagaagaaggaactgcagagaaatccaagaaactgaggactacaaatgagcattctcagacttgtgattggggtaatctccttcaggacattattctccaagtatttaaatatttgcctcttcttgaccgggctcatg
  • Show more
Description: A cloning plasmid for the FBXL3 gene.

PRND cloning plasmid

CSB-CL890741HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 531
  • Sequence: atgaggaagcacctgagctggtggtggctggccactgtctgcatgctgctcttcagccacctctctgcggtccagacgaggggcatcaagcacagaatcaagtggaaccggaaggccctgcccagcactgcccagatcactgaggcccaggtggctgagaaccgcccgggagcctt
  • Show more
Description: A cloning plasmid for the PRND gene.

BAG5 cloning plasmid

CSB-CL890743HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atggatatgggaaaccaacatccttctattagtaggcttcaggaaatccaaaaggaagtaaaaagtgtagaacagcaagttatcggcttcagtggtctgtcagatgacaagaattacaagaaactggagaggattctaacaaaacagctttttgaaatagactctgtagatactg
  • Show more
Description: A cloning plasmid for the BAG5 gene.

PLDN cloning plasmid

CSB-CL890745HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgagtgtccctgggccgtcgtctccggacggggccctgacacggccaccctactgcctggaggccggggagccgacgcctggtttaagtgacacttctccagatgaagggttaatagaggacttgactatagaagacaaagcagtggagcaactggcagaaggattgctttctca
  • Show more
Description: A cloning plasmid for the PLDN gene.

ZDHHC8 cloning plasmid

CSB-CL890747HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 129
  • Sequence: atggacagaggcacccagggcccccaccgtccttctgacacagcctgtgggctcccggaccgagtgtcccccgccaggctactcctaactaacgcgttgcctttcacggaccccgctggaagcttgtag
Description: A cloning plasmid for the ZDHHC8 gene.

VANGL2 cloning plasmid

CSB-CL890750HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1566
  • Sequence: ATGGACACCGAGTCCCAGTACTCGGGCTATTCCTACAAGTCGGGCCACTCCCGCAGCTCCCGCAAGCACAGGGACCGCCGGGACCGACACCGCTCTAAGAGTCGAGATGGGGGCCGAGGGGACAAGTCGGTGACAATCCAGGCTCCCGGGGAGCCCCTGCTGGACAATGAGTCCA
  • Show more
Description: A cloning plasmid for the VANGL2 gene.

TBC1D24 cloning plasmid

CSB-CL890752HU-10ug 10ug
EUR 580
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1680
  • Sequence: ATGGACTCTCCAGGATACAACTGCTTCGTGGACAAAGACAAGATGGACGCTGCCATCCAGGACCTGGGGCCCAAGGAGCTGAGCTGCACTGAACTGCAGGAACTGAAGCAGCTGGCGCGCCAGGGCTACTGGGCCCAAAGCCACGCCCTGCGGGGAAAGGTGTACCAGCGCCTGA
  • Show more
Description: A cloning plasmid for the TBC1D24 gene.

TTC7A cloning plasmid

CSB-CL890754HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: ATGGCAACTCGAGATGTGGTGCTGAGCCGGGTGCCGGAGCAGGAGGAGGACCGGACAGTGAGCTTGCAGAATGCCGCAGCCATCTATGACCTCCTGAGCATCACGTTGGGCAGAAGGGGACAGTACGTCATGCTCTCGGAGTGCCTGGAGCGAGCCATGAAGTTTGCGTTTGGAG
  • Show more
Description: A cloning plasmid for the TTC7A gene.

FZD4 cloning plasmid

CSB-CL890755HU-10ug 10ug
EUR 562
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1614
  • Sequence: ATGGCCTGGCGGGGCGCAGGGCCGAGCGTCCCGGGGGCGCCCGGGGGCGTCGGTCTCAGTCTGGGGTTGCTCCTGCAGTTGCTGCTGCTCCTGGGGCCGGCGCGGGGCTTCGGGGACGAGGAAGAGCGGCGCTGCGACCCCATCCGCATCTCCATGTGCCAGAACCTCGGCTACA
  • Show more
Description: A cloning plasmid for the FZD4 gene.

STAP1 cloning plasmid

CSB-CL890756HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atgatggctaagaagcccccaaaaccagcccctcgcaggatcttccaggaaaggttaaagattactgctctacctttgtactttgaaggttttttattaatcaagcggtcaggataccgggagtatgagcattactggacagagttgagaggaactactcttttcttttataccga
  • Show more
Description: A cloning plasmid for the STAP1 gene.

PADI4 cloning plasmid

CSB-CL890757HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1992
  • Sequence: atggcccaggggacattgatccgtgtgaccccagagcagcccacccatgccgtgtgtgtgctgggcaccttgactcagcttgacatctgcagctctgcccctgaggactgcacgtccttcagcatcaacgcctccccaggggtggtcgtggatattgcccacagccctccagcca
  • Show more
Description: A cloning plasmid for the PADI4 gene.

PCDHGB4 cloning plasmid

CSB-CL890762HU-10ug 10ug
EUR 784
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2412
  • Sequence: atggggagcggcgccggggagctgggccgggctgagaggctgccagtgctctttctcttcctgctgtctttgttctgcccggcgctctgtgagcagatccgctacaggattcccgaggaaatgcccaagggctccgtagtggggaacctcgccacggacctggggttcagcgtcc
  • Show more
Description: A cloning plasmid for the PCDHGB4 gene.

PCDHA6 cloning plasmid

CSB-CL890763HU-10ug 10ug
EUR 909
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2853
  • Sequence: atggtgtttaccccggaggatagattgggaaagcaatgtctgctcctcccgcttctgctcctcgcagcctggaaggtggggagcggccagctccactactccgtacccgaggaggccaaacacggcaccttcgtgggccggatcgcgcaggacctggggctggagctggcggagc
  • Show more
Description: A cloning plasmid for the PCDHA6 gene.

PACSIN2 cloning plasmid

CSB-CL890765HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1461
  • Sequence: atgtctgtcacatatgatgattccgttggagtagaagtgtccagcgacagcttctgggaggtcgggaactacaagcggactgtgaagcggatcgacgatggccaccgcctgtgcagcgacctcatgaactgcctgcatgagcgggcgcgcatcgagaaggcgtatgcgcagcagc
  • Show more
Description: A cloning plasmid for the PACSIN2 gene.

SNX6 cloning plasmid

CSB-CL890766HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atgacgaaggaagaattcacaaagatgaaacaggaactggaagctgaatatttggcaatattcaagaagacagttgcgatgcatgaagtgttcctgtgtcgtgtggcagcacatcctattttgagaagagatttaaatttccatgtcttcttggaatataatcaagatttgagtgt
  • Show more
Description: A cloning plasmid for the SNX6 gene.

DUSP12 cloning plasmid

CSB-CL890767HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1023
  • Sequence: atgttggaggctccgggcccgagtgatggctgcgagctcagcaaccccagcgccagcagagtcagctgtgccgggcagatgctggaagtgcagccaggattgtatttcggtggggccgcggccgtcgcggagccagatcacctgagggaagcgggcatcacggccgtgctaacag
  • Show more
Description: A cloning plasmid for the DUSP12 gene.

PSMD13 cloning plasmid

CSB-CL890768HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1131
  • Sequence: atgaaggacgtaccgggcttcctacagcagagccagagctccgggcccgggcagcccgctgtgtggcaccgtctggaggagctctacacgaagaagttgtggcatcagctgacacttcaggtgcttgattttgtgcaggatccgtgctttgcccaaggagatggtctcattaagc
  • Show more
Description: A cloning plasmid for the PSMD13 gene.

ST3GAL5 cloning plasmid

CSB-CL890769HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgccaagtgagtacacctatgtgaaactgagaagtgattgctcgaggccttccctgcaatggtacacccgagctcaaagcaagatgagaaggcccagcttgttattaaaagacatcctcaaatgtacattgcttgtgtttggagtgtggatcctttatatcctcaagttaaatt
  • Show more
Description: A cloning plasmid for the ST3GAL5 gene.

COG5 cloning plasmid

CSB-CL890771HU-10ug 10ug
EUR 801
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2472
  • Sequence: atgggctgggtgggcgggcggcgccgggattctgcgtcaccacctgggcggagccgttctgctgctgacgacatcaacccggcacctgccaacatggaaggtggcggcggcagcgtcgctgtagctggcctcggagctcgaggctctggagcggctgcagctacagtccgggaac
  • Show more
Description: A cloning plasmid for the COG5 gene.

AP4E1 cloning plasmid

CSB-CL890772HU-10ug 10ug
EUR 1248
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3414
  • Sequence: atgagcgacatagtggagaagacgctgacggcgctgccgggactctttctgcagaaccagcccggtggtgggcccgcggccgccaaggcgtccttctcctcgaggctgggcagccttgtccgcggcatcacagccctcacctccaagcacgaagaagaaaaattaatccagcagg
  • Show more
Description: A cloning plasmid for the AP4E1 gene.

DHDH cloning plasmid

CSB-CL890780HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1005
  • Sequence: atggcgctgcgctggggcatcgtgtctgtcggcctcatctccagcgacttcacagccgtgctgcagacgctgcctcgctctgagcaccaggtggtggcggtggcggcccgcgatctgagccgtgcgaaggagtttgcacagaaacacgacatccccaaggcctacggctcctatg
  • Show more
Description: A cloning plasmid for the DHDH gene.

MGAT4B cloning plasmid

CSB-CL890781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 891
  • Sequence: atgatgtacgcgcagtccaaaggcatctactacgtgcagctggaggatgacatcgtggccaagcccaactacctgagcaccatgaagaactttgcactgcagcagccttcagaggactggatgatcctggagttctcccagctgggcttcattggtaagatgttcaagtcgctgga
  • Show more
Description: A cloning plasmid for the MGAT4B gene.

CLCA2 cloning plasmid

CSB-CL890782HU-10ug 10ug
EUR 902
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2832
  • Sequence: atgacccaaaggagcattgcaggtcctatttgcaacctgaagtttgtgactctcctggttgccttaagttcagaactcccattcctgggagctggagtacagcttcaagacaatgggtataatggattgctcattgcaattaatcctcaggtacctgagaatcagaacctcatct
  • Show more
Description: A cloning plasmid for the CLCA2 gene.

MCM8 cloning plasmid

CSB-CL890907HU1-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2523
  • Sequence: atgaatggagagtatagaggcagaggatttggacgaggaagatttcaaagctggaaaaggggaagaggtggtgggaacttctcaggaaaatggagagaaagagaacacagacctgatctgagtaaaaccacaggaaaacgtacttctgaacaaaccccacagtttttgctttcaa
  • Show more
Description: A cloning plasmid for the MCM8 gene.

MCM8 cloning plasmid

CSB-CL890907HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1812
  • Sequence: atggcttttctttgtgctgcatgtggagaaattcagagctttcctcttccagatggaaaatacagtcttcccacaaagtgtcctgtgcctgtgtgtcgaggcaggtcatttactgctctccgcagctctcctctcacagttacgatggactggcagtcaatcaaaatccaggaat
  • Show more
Description: A cloning plasmid for the MCM8 gene.

MCM8 cloning plasmid

CSB-CL890907HU3-10ug 10ug
EUR 850
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2643
  • Sequence: ATGAATGGAGAGTATAGAGGCAGAGGATTTGGACGAGGAAGATTTCAAAGCTGGAAAAGGGGAAGAGGTGGTGGGAACTTCTCAGGAAAATGGAGAGAAAGAGAACACAGACCTGATCTGAGTAAAACCACAGGAAAACGTACTTCTGAACAAACCCCACAGTTTTTGCTTTCAA
  • Show more
Description: A cloning plasmid for the MCM8 gene.

RASAL2 cloning plasmid

CSB-CL890908HU-10ug 10ug
EUR 1333
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3789
  • Sequence: ATGTTCCCGGCGCTGGAGTCCGACTCGCCGCTGCCCCCGGAGGACCTGGACGCGGTTGTCCCAGTCAGTGGAGCCGTCGCCGGTGGCATGTTGGATCGGATCCTTCTGGAGTCCGTGTGCCAGCAACAGAGCTGGGTCCGGGTGTACGATGTGAAAGGACCACCCACCCACCGTC
  • Show more
Description: A cloning plasmid for the RASAL2 gene.

TUBE1 cloning plasmid

CSB-CL890909HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1428
  • Sequence: atgacccagtcggtggtcgtacaggtcggccagtgcggaaaccagatcggctgctgcttctgggacctggcactaagggagcacgccgcggtcaaccagaaaggaatttatgatgaggcaataagcagcttctttagaaatgtggacaccagagtggttggtgatggtggaagta
  • Show more
Description: A cloning plasmid for the TUBE1 gene.

TUBE1 cloning plasmid

CSB-CL890909HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1428
  • Sequence: atgacccagtcggtggtcgtacaggtcggccagtgcggaaaccagatcggctgctgcttctgggacctggcactaagggagcacgccgcggtcaaccagaaaggaatttatgatgaggcaataagcagcttctttagaaatgtggacaccagagtggttggtgatggtggaagta
  • Show more
Description: A cloning plasmid for the TUBE1 gene.

GGA1 cloning plasmid

CSB-CL890911HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 270
  • Sequence: atggagcccgcgatggagccggagactctggaggcgcgaatcaatagagccacgaaccccctgaacaaggagctcgactgggccagcatcaacggcttctgcgagcagctcaacgaggactttgaggggcctccactcgccacccggctgctggcccacaagatccagtccccaca
  • Show more
Description: A cloning plasmid for the GGA1 gene.

GGA1 cloning plasmid

CSB-CL890911HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1659
  • Sequence: atggagcccgcgatggagccggagactctggaggcgcgaatcaatagagccacgaaccccctgaacaaggagctcgactgggccagcatcaacggcttctgcgagcagctcaacgaggactttgaggggcctccactcgccacccggctgctggcccacaagatccagtccccac
  • Show more
Description: A cloning plasmid for the GGA1 gene.

KCND3 cloning plasmid

CSB-CL890913HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1911
  • Sequence: ATGGCGGCCGGAGTTGCGGCCTGGCTGCCTTTTGCCCGGGCTGCGGCCATCGGGTGGATGCCGGTGGCCAACTGCCCCATGCCCCTGGCCCCGGCCGACAAGAACAAGCGGCAGGATGAGCTGATTGTCCTCAACGTGAGTGGGCGGAGGTTCCAGACCTGGAGGACCACGCTGG
  • Show more
Description: A cloning plasmid for the KCND3 gene.

KCND3 cloning plasmid

CSB-CL890913HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1911
  • Sequence: ATGGCGGCCGGAGTTGCGGCCTGGCTGCCTTTTGCCCGGGCTGCGGCCATCGGGTGGATGCCGGTGGCCAACTGCCCCATGCCCCTGGCCCCGGCCGACAAGAACAAGCGGCAGGATGAGCTGATTGTCCTCAACGTGAGTGGGCGGAGGTTCCAGACCTGGAGGACCACGCTGG
  • Show more
Description: A cloning plasmid for the KCND3 gene.

DBR1 cloning plasmid

CSB-CL890914HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1635
  • Sequence: atgcgggtggctgtggctggctgctgccacggcgagctggataagatctatgagacgctggcgctggcagagcggcgcggcccggggcctgtcgacctcttgctgtgctgcggcgacttccaggcggtgcgcaacgaggcggatctacgctgcatggccgtgccgcccaagtatc
  • Show more
Description: A cloning plasmid for the DBR1 gene.

FBXO10 cloning plasmid

CSB-CL890915HU-10ug 10ug
EUR 913
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2871
  • Sequence: ATGGAGGCTGGTGGCCTCCCCTTGGAGCTGTGGCGCATGATCTTAGCCTACTTGCACCTTCCCGACCTGGGCCGCTGCAGCCTGGTATGCAGGGCCTGGTATGAACTGATCCTCAGTCTCGACAGCACCCGCTGGCGGCAGCTGTGTCTGGGTTGCACCGAGTGCCGCCATCCCA
  • Show more
Description: A cloning plasmid for the FBXO10 gene.

APPL1 cloning plasmid

CSB-CL890917HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2130
  • Sequence: atgccggggatcgacaagctgcccatcgaggagacgctggaggacagcccgcagacaaggtctttactgggtgtatttgaagaagatgccacagctatttccaactatatgaaccagttgtatcaagctatgcatcggatttatgatgcacagaatgaattaagtgcagcaacac
  • Show more
Description: A cloning plasmid for the APPL1 gene.

CDC42EP3 cloning plasmid

CSB-CL890918HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atgccagccaagaccccaatttacctgaaagcagccaataacaagaaaggaaagaaatttaaactgagggacattctgtctcctgatatgatcagtcccccgcttggagactttcgccacaccatccacattggcaaagagggccagcacgatgtctttggagatatttcctttct
  • Show more
Description: A cloning plasmid for the CDC42EP3 gene.

ADAM21 cloning plasmid

CSB-CL890919HU-10ug 10ug
EUR 717
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2169
  • Sequence: ATGGCAGTGGATGGGACCCTCGTGTACATCAGGGTCACTCTTCTGCTGCTCTGGCTTGGGGTATTTTTGTCTATTTCCGGCTACTGTCAGGCTGGGCCCTCCCAGCATTTCACTTCCCCGGAAGTGGTGATCCCCTTGAAGGTGATCAGCAGGGGCAGAAGTGCAAAGGCTCCTG
  • Show more
Description: A cloning plasmid for the ADAM21 gene.

PRDM4 cloning plasmid

CSB-CL890920HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2406
  • Sequence: atgcatcacaggatgaatgaaatgaacctgagtccagtggggatggagcagctgacttcatcctctgtgagcaatgccttgccagtctcaggaagtcacctgggattggctgcctcacccactcacagtgccatccctgccccaggcctcccagtggcaattccaaacctgggtc
  • Show more
Description: A cloning plasmid for the PRDM4 gene.

FBXO5 cloning plasmid

CSB-CL890922HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgagccggcgcccctgcagctgcgccctacggccaccccgctgctcctgcagcgccagccccagcgcagtgacagccgccgggcgccctcgaccctcggatagttgtaaagaagaaagttctaccctttctgtcaaaatgaagtgtgattttaattgtaaccatgttcattccg
  • Show more
Description: A cloning plasmid for the FBXO5 gene.

DSE cloning plasmid

CSB-CL890925HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2877
  • Sequence: atgaggactcacacacggggggctcccagtgtgtttttcatatatttgctttgctttgtgtcagcctacatcaccgacgagaacccagaagttatgattcccttcaccaatgccaactacgacagccatcccatgctgtacttctccagggcagaagtggcggagctgcagctca
  • Show more
Description: A cloning plasmid for the DSE gene.

BRPF3 cloning plasmid

CSB-CL890928HU-10ug 10ug
EUR 896
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2808
  • Sequence: atgaggaagcctcgtcggaagtcccggcagaatgccgagggccggcgttccccgtccccctacagtctcaagtgctcacccacccgggagaccctgacatatgcccaggcccagcggattgtcgaggtagacattgatggacgcctgcatcgtatcagcatctatgacccactca
  • Show more
Description: A cloning plasmid for the BRPF3 gene.

WWC3 cloning plasmid

CSB-CL890929HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 510
  • Sequence: atgcagtgcctgcttccgtatcagtccaaggagccctcgtgtttgccacctttacctttgaacctccccctgcctccctgcctgtgtccgcttttgcagctcaatgcagccatgacaaggaaagaaaagacaaaggaaggccagagagccgcgcagttctctgcaggtgcagatgc
  • Show more
Description: A cloning plasmid for the WWC3 gene.

RIMKLB cloning plasmid

CSB-CL890931HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 924
  • Sequence: atgtgtagttctgtggctgccaagttgtggtttttgacagatcgtcgcatcagggaagactatcctcaaaaagagattttacgagcattgaaggccaaatgttgtgaggaggaactggactttagggctgtggtgatggatgaggtggtgctgacaatcgagcaaggaaacctggg
  • Show more
Description: A cloning plasmid for the RIMKLB gene.

NDRG4 cloning plasmid

CSB-CL890932HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1020
  • Sequence: atgccggagtgctgggatggggaacatgacatcgagacaccctacggccttctgcatgtagtgatccggggctcccccaaggggaaccgcccagccatcctcacctaccatgatgtgggcctcaaccacaaactatgcttcaacaccttcttcaacttcgaggacatgcaggaga
  • Show more
Description: A cloning plasmid for the NDRG4 gene.

PYCARD cloning plasmid

CSB-CL890936HU1-10ug 10ug
EUR 236
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atggacgccttggacctcaccgacaagctggtcagcttctacctggagacctacggcgccgagctcaccgctaacgtgctgcgcgacatgggcctgcaggagatggccgggcagctgcaggcggccacgcaccagggctctggagccgcgccagctgggatccaggcccctcctca
  • Show more
Description: A cloning plasmid for the PYCARD gene.

PYCARD cloning plasmid

CSB-CL890936HU2-10ug 10ug
EUR 224
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atggggcgcgcgcgcgacgccatcctggatgcgctggagaacctgaccgccgaggagctcaagaagttcaagctgcaggcggccacgcaccagggctctggagccgcgccagctgggatccaggcccctcctcagtcggcagccaagccaggcctgcactttatagaccagcaccg
  • Show more
Description: A cloning plasmid for the PYCARD gene.

MGAT4A cloning plasmid

CSB-CL890937HU-10ug 10ug
EUR 560
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1608
  • Sequence: ATGAGGCTCCGCAATGGAACTGTAGCCACTGCTTTAGCATTTATCACTTCCTTCCTTACTTTGTCTTGGTATACTACATGGCAAAATGGGAAAGAAAAACTGATTGCTTATCAACGAGAATTCCTTGCTTTGAAAGAACGTCTTCGAATAGCTGAACACAGAATCTCACAGCGCT
  • Show more
Description: A cloning plasmid for the MGAT4A gene.

SLC45A2 cloning plasmid

CSB-CL890941HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 732
  • Sequence: atgggtagcaacagtgggcaggctggccgccacatctataaatccctagctgatgatggcccctttgactctgtggagccgcctaaaagacccaccagcagactcatcatgcacagcatggccatgttcggaagagagttctgctacgcggtggaggcagcgtatgtgaccccagt
  • Show more
Description: A cloning plasmid for the SLC45A2 gene.

SLC45A2 cloning plasmid

CSB-CL890941HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1383
  • Sequence: atgggtagcaacagtgggcaggctggccgccacatctataaatccctagctgatgatggcccctttgactctgtggagccgcctaaaagacccaccagcagactcatcatgcacagcatggccatgttcggaagagagttctgctacgcggtggaggcagcgtatgtgaccccag
  • Show more
Description: A cloning plasmid for the SLC45A2 gene.

PCDHA4 cloning plasmid

CSB-CL890942HU-10ug 10ug
EUR 780
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2397
  • Sequence: atggagttttcctggggaagcggccaggaatcccggcgtctgctgctcttacttcttctcctcgcagcctgggaggcagggaacggtcagctccactactcggtctccgaggaggccaaacacggcaccttcgtgggccgcatcgcgcaggacctgggactggagctggcggagc
  • Show more
Description: A cloning plasmid for the PCDHA4 gene.

PPIE cloning plasmid

CSB-CL890944HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 906
  • Sequence: atggccaccaccaagcgcgtcttgtacgtgggtggactggcagaggaagtggacgacaaagttcttcatgctgcgttcattccttttggagacatcacagatattcagattcctctggattatgaaacagaaaagcaccgaggatttgcttttgttgaatttgagttggcagagga
  • Show more
Description: A cloning plasmid for the PPIE gene.

LIMCH1 cloning plasmid

CSB-CL891463HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atggattccgaaagacaagtcaaggttaaggacactgatgacattgaaagtcctaaacgcagtatccgagacagtggctacatcgactgctgggattccgagcgcagcgactccctctctcctcctcgccacggcagagatgattccttcgacagcctggattcctttggctctcg
  • Show more
Description: A cloning plasmid for the LIMCH1 gene.

TRAK1 cloning plasmid

CSB-CL891465HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2067
  • Sequence: atgtccctgcgagacaagggcggggaagaagaatgttttgaatacgactgccaggatgaagagaggaagccaacccacaggcagcatgacacccaggacctcttggaagaggttttatgtgctgaaagagttggccagatgactaagacatataatgacatagatgctgtcactc
  • Show more
Description: A cloning plasmid for the TRAK1 gene.

SHOC2 cloning plasmid

CSB-CL891468HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1749
  • Sequence: atgagtagtagtttaggaaaagaaaaagactctaaagaaaaagatcccaaagtaccatcagccaaggaaagagaaaaggaggcaaaagcctctggaggttttgggaaagagagcaaagaaaaagaacctaagaccaaagggaaagatgccaaagatggaaagaaggactccagtg
  • Show more
Description: A cloning plasmid for the SHOC2 gene.

SMC3 cloning plasmid

CSB-CL891469HU-10ug 10ug
EUR 1290
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3654
  • Sequence: atgtacataaagcaggtgattatccagggttttcgaagttacagagatcaaacaattgtagatcccttcagttcaaaacataatgtgattgtgggcagaaatggatctggaaaaagtaaccttttttatgcaattcagtttgttctcagtgatgagtttagtcatcttcgtccag
  • Show more
Description: A cloning plasmid for the SMC3 gene.

HOOK1 cloning plasmid

CSB-CL891526HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2187
  • Sequence: atggaggagacgcagccgccgccgcagcctaagctgcccctgtgcgacagcctcatgatctggctgcagacattcaatactgcctcaccttgtcaagatgtcaaacagctgactagtggagttgccatggcacaagttcttcatcaaattgatgcagcttggtttaacgaatctt
  • Show more
Description: A cloning plasmid for the HOOK1 gene.

ZFP112 cloning plasmid

CSB-CL891528HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2724
  • Sequence: atggtgacattcaaggatgttgctgtggtcttcactgaggaggagctggggctgctggactctgtccagaggaagctgtaccgagatgtgatgctggagaacttcaggaacctgctcttagtagcacatcagcccttcaagccagacctaatatcccagctggagagagaagaaa
  • Show more
Description: A cloning plasmid for the ZFP112 gene.

PURG cloning plasmid

CSB-CL891529HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1044
  • Sequence: ATGGAAAGAGCCAGGCGAAGGGGAGGCGGCGGCGGCCGCGGCCGCGGAGGCAAGAATGTAGGGGGCTCTGGCCTAAGCAAGAGTAGACTCTATCCCCAGGCCCAGCACTCCCACTACCCCCACTACGCGGCCTCAGCCACCCCTAATCAGGCCGGGGGCGCAGCCGAAATCCAGG
  • Show more
Description: A cloning plasmid for the PURG gene.

CDC23 cloning plasmid

CSB-CL891530HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1776
  • Sequence: atggtcccggtggctgtgacggcggcagtggcgcctgtcctgtccataaacagcgatttctcagatttgcgggaaattaaaaagcaactgctgcttattgcgggccttacccgggagcggggcctactacacagtagcaaatggtcggcggagttggctttctctctccctgcat
  • Show more
Description: A cloning plasmid for the CDC23 gene.

HSPB8 cloning plasmid

CSB-CL891531HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 591
  • Sequence: atggctgacggtcagatgcccttctcctgccactacccaagccgcctgcgccgagaccccttccgggactctcccctctcctctcgcctgctggatgatggctttggcatggaccccttcccagacgacttgacagcctcttggcccgactgggctctgcctcgtctctcctccgc
  • Show more
Description: A cloning plasmid for the HSPB8 gene.

FBXO4 cloning plasmid

CSB-CL891538HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: atggcgggaagcgagccgcgcagcggaacaaactcgccgccgccgcccttcagcgactggggccgcctggaggcggccatcctcagcggctggaagaccttctggcagtcagtgagcaaggagagggtggcgcgtacgacctcacgggaggaggtggatgaggcggccagcaccc
  • Show more
Description: A cloning plasmid for the FBXO4 gene.

ANGPTL2 cloning plasmid

CSB-CL891539HU-10ug 10ug
EUR 524
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atgaggccactgtgcgtgacatgctggtggctcggactgctggctgccatgggagctgttgcaggccaggaggacggttttgagggcactgaggagggctcgccaagagagttcatttacctaaacaggtacaagcgggcgggcgagtcccaggacaagtgcacctacaccttca
  • Show more
Description: A cloning plasmid for the ANGPTL2 gene.

ELF5 cloning plasmid

CSB-CL891540HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 768
  • Sequence: atgttggactcggtgacacacagcaccttcctgcctaatgcatccttctgcgatcccctgatgtcgtggactgatctgttcagcaatgaagagtactaccctgcctttgagcatcagacagcctgtgactcatactggacatcagtccaccctgaatactggactaagcgccatgt
  • Show more
Description: A cloning plasmid for the ELF5 gene.

PADI1 cloning plasmid

CSB-CL891543HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1992
  • Sequence: atggccccaaagagagttgtgcagctgtccctgaagatgcctacccatgccgtgtgtgtggtgggagtcgaggcacatgtggacattcacagtgatgtgcccaagggtgccaacagcttcagggtctctggaagctccggggtggaggtcttcatggtctacaaccgcacacgtg
  • Show more
Description: A cloning plasmid for the PADI1 gene.

INTU cloning plasmid

CSB-CL891544HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atggcctctgtggcttcgtgcgattcgcgtccgagctcagacgagctccctggagacccctcttcacaagaagaagatgaggactatgattttgaagatcgggtcagcgactcgggttcatattcctcagcgagtagcgattatgatgatcttgagcctgaatggctggacagtg
  • Show more
Description: A cloning plasmid for the INTU gene.

INTU cloning plasmid

CSB-CL891544HU2-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2829
  • Sequence: atggcctctgtggcttcgtgcgattcgcgtccgagctcagacgagctccctggagacccctcttcacaagaagaagatgaggactatgattttgaagatcgggtcagcgactcgggttcatattcctcagcgagtagcgattatgatgatcttgagcctgaatggctggacagtg
  • Show more
Description: A cloning plasmid for the INTU gene.

ASAP1 cloning plasmid

CSB-CL891546HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 111
  • Sequence: atgaatgcacatctctcagatgtgttgaagcatccattgcatccattttttattattttcttagttttgttcttggacaaatttaaacttttaaaagattattcaagatga
Description: A cloning plasmid for the ASAP1 gene.

KIF26A cloning plasmid

CSB-CL891547HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atgagcgagagtggggctgcctccccaggcgcccgcacccgcagcctcaagtcccccaagaagagggccacaggtctgcagcggcggcgcctgattcccgccccactgcccgacaccactgccctgggccgtaagcccagcctccccgggcagtgggtggacctgcccccgcccct
  • Show more
Description: A cloning plasmid for the KIF26A gene.

PADI3 cloning plasmid

CSB-CL891552HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1995
  • Sequence: ATGTCGCTGCAGAGAATCGTGCGTGTGTCCCTGGAGCATCCCACCAGCGCGGTGTGTGTGGCTGGCGTGGAGACCCTCGTGGACATTTATGGGTCAGTGCCTGAGGGCACAGAAATGTTTGAGGTCTATGGGACGCCTGGCGTGGACATCTACATCTCTCCCAACATGGAGAGGG
  • Show more
Description: A cloning plasmid for the PADI3 gene.

CLEC4E cloning plasmid

CSB-CL891553HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atgaattcatctaaatcatctgaaacacaatgcacagagagaggatgcttctcttcccaaatgttcttatggactgttgctgggatccccatcctatttctcagtgcctgtttcatcaccagatgtgttgtgacatttcgcatctttcaaacctgtgatgagaaaaagtttcagct
  • Show more
Description: A cloning plasmid for the CLEC4E gene.

SPATA2 cloning plasmid

CSB-CL891556HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1563
  • Sequence: atggggaagcccagttcaatggatactaaattcaaggatgacttatttcggaagtacgtgcagttccatgagagcaaagtggataccaccaccagcaggcagcggcctggcagcgatgagtgcctgcgggtggcagcctcaaccctgctcagcctgcacaaggtggatccctttt
  • Show more
Description: A cloning plasmid for the SPATA2 gene.

BARX2 cloning plasmid

CSB-CL891557HU-10ug 10ug
EUR 345
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 840
  • Sequence: ATGCACTGCCACGCCGAGCTGAGGCTGAGCTCGCCCGGCCAGCTCAAAGCAGCCAGGCGGCGCTACAAGACTTTCATGATCGACGAGATCCTCTCCAAGGAGACCTGCGATTACTTTGAGAAACTTTCCCTCTACTCCGTGTGCCCGTCGCTGGTCGTGCGACCCAAGCCCCTGCA
  • Show more
Description: A cloning plasmid for the BARX2 gene.

CLEC4A cloning plasmid

CSB-CL891558HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atgacttcggaaatcacttatgctgaagtgaggttcaaaaatgaattcaagtcctcaggcatcaacacagcctcttctgcagcttccaaggagaggactgcccctctcaaaagtaataccggattccccaagctgctttgtgcctcactgttgatatttttcctgctattggcaat
  • Show more
Description: A cloning plasmid for the CLEC4A gene.

USP18 cloning plasmid

CSB-CL891559HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1119
  • Sequence: atgagcaaggcgtttgggctcctgaggcaaatctgtcagtccatcctggctgagtcctcgcagtccccggcagatcttgaagaaaagaaggaagaagacagcaacatgaagagagagcagcccagagagcgtcccagggcctgggactaccctcatggcctggttggtttacaca
  • Show more
Description: A cloning plasmid for the USP18 gene.

SUFU cloning plasmid

CSB-CL891560HU-10ug 10ug
EUR 517
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: atggcggagctgcggcctagcggcgcccccggccccaccgcgcccccggcccctggcccgactgcccccccggccttcgcttcgctctttcccccgggactgcacgccatctacggagagtgccgccgcctttaccctgaccagccgaacccgctccaggttaccgctatcgtca
  • Show more
Description: A cloning plasmid for the SUFU gene.

ATP1B4 cloning plasmid

CSB-CL891562HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1074
  • Sequence: atgagaaggcaactccggtccagaagggctccatcctttccttacagttatcgctacagactcgatgatccggatgaagcgaaccagaactacttagcagatgaagaggaggaagcagaagaagaggctcgggtgacggtggtgcccaaatcggaggaggaggaagaagaggagg
  • Show more
Description: A cloning plasmid for the ATP1B4 gene.

PCDHA12 cloning plasmid

CSB-CL891563HU1-10ug 10ug
EUR 776
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2379
  • Sequence: ATGGTGATTATCGGACCAAGAGGCCCGGGATCCCAGCGTCTGCTGCTCTCGCTTCTGCTCCTTGCAGCCTGGGAGGTGGGGAGCGGCCAGCTCCACTACTCCGTCTACGAGGAGGCCAAACACGGCACCTTCGTGGGCCGCATCGCTCAGGACCTGGGGCTGGAGCTGGCGGAGC
  • Show more
Description: A cloning plasmid for the PCDHA12 gene.

PCDHA12 cloning plasmid

CSB-CL891563HU2-10ug 10ug
EUR 776
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2379
  • Sequence: ATGGTGATTATCGGACCAAGAGGCCCGGGATCCCAGCGTCTGCTGCTCTCGCTTCTGCTCCTTGCAGCCTGGGAGGTGGGGAGCGGCCAGCTCCACTACTCCGTCTACGAGGAGGCCAAACACGGCACCTTCGTGGGCCGCATCGCTCAGGACCTGGGGCTGGAGCTGGCGGAGC
  • Show more
Description: A cloning plasmid for the PCDHA12 gene.

GABRQ cloning plasmid

CSB-CL891564HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1899
  • Sequence: ATGGGCATCCGAGGCATGCTGCGAGCCGCAGTGATCCTGCTGCTCATCAGGACCTGGCTCGCGGAGGGCAACTACCCCAGTCCCATCCCGAAATTCCACTTCGAGTTCTCCTCTGCTGTGCCCGAAGTCGTCCTGAACCTCTTCAACTGCAAAAATTGTGCAAATGAAGCTGTGG
  • Show more
Description: A cloning plasmid for the GABRQ gene.

SNX7 cloning plasmid

CSB-CL891565HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: atggacatgaactccttcagccctatgatgccaacatcccctttatcaatgataaaccaaatcaagtttgaggatgaaccagatttaaaggatctcttcatcacagttgatgaacctgaaagtcatgttactacaatagaaactttcattacgtataggattattactaagacat
  • Show more
Description: A cloning plasmid for the SNX7 gene.

SNX7 cloning plasmid

CSB-CL891565HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1011
  • Sequence: atggacatgaactccttcagccctatgatgccaacatcccctttatcaatgataaaccaaatcaagtttgaggatgaaccagatttaaaggatctcttcatcacagttgatgaacctgaaagtcatgttactacaatagaaactttcattacgtataggattattactaagacat
  • Show more
Description: A cloning plasmid for the SNX7 gene.

PLA2G2D cloning plasmid

CSB-CL891566HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 438
  • Sequence: atggaacttgcactgctgtgtgggctggtggtgatggctggtgtgattccaatccagggcgggatcctgaacctgaacaagatggtcaagcaagtgactgggaaaatgcccatcctctcctactggccctacggctgtcactgcggactaggtggcagaggccaacccaaagatgc
  • Show more
Description: A cloning plasmid for the PLA2G2D gene.

GTF2A1L cloning plasmid

CSB-CL891567HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1437
  • Sequence: atggcctgcctcaacccggtgcctaaactctacagatctgtaattgaagatgtaattgaaggagttcggaatctatttgctgaagaaggtatagaggaacaagttttaaaagacttgaagcagctctgggaaaccaaggttttgcagtctaaagcaacagaagacttcttcagaa
  • Show more
Description: A cloning plasmid for the GTF2A1L gene.

RABL2B cloning plasmid

CSB-CL891569HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 300
  • Sequence: atggcagaagacaaaaccaaaccgagtgagttggaccaagggaagtatgatgctgatgacaacgtgaagatcatctgcctgggagacagcgcagtgggcaaatccaaactcatggagagatttctcatggatggctttcagccacagcagctgtccacgtacgccctgaccctgta
  • Show more
Description: A cloning plasmid for the RABL2B gene.

RABL2B cloning plasmid

CSB-CL891569HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: atggcagaagacaaaaccaaaccgagtgagttggaccaagggaagtatgatgctgatgacaacgtgaagatcatctgcctgggagacagcgcagtgggcaaatccaaactcatggagagatttctcatggatggctttcagccacagcagctgtccacgtacgccctgaccctgta
  • Show more
Description: A cloning plasmid for the RABL2B gene.

GPR34 cloning plasmid

CSB-CL891571HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atgagaagtcataccataacaatgacgacaacttcagtcagcagctggccttactcctcccacagaatgcgctttataaccaatcatagcgaccaaccgccacaaaacttctcagcaacaccaaatgttactacctgtcccatggatgaaaaattgctatctactgtgttaacca
  • Show more
Description: A cloning plasmid for the GPR34 gene.

PSG11 cloning plasmid

CSB-CL891577HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atgcacgcagcagagatcatggggcccctctcagcccctccctgcacagagcacatcaaatggaaggggctcctgctcacagtggagactcccaagccctccatctccagcagcaacttaaaccccagggaggccatggagactgtgatcttaacctgtaatcctgagactccgga
  • Show more
Description: A cloning plasmid for the PSG11 gene.

KCNE1L cloning plasmid

CSB-CL891715HU-10ug 10ug
EUR 230
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atgaactgcagcgagagccagcggctgcgaacccttctgagccgcctgttgctcgagctgcaccaccggggtaatgccagcggcttgggcgctggccctcgtcccagcatgggcatgggggtcgtgcctgaccctttcgtgggccgcgaggtgaccagcgccaagggcgacgacgc
  • Show more
Description: A cloning plasmid for the KCNE1L gene.

TRMT6 cloning plasmid

CSB-CL891716HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1494
  • Sequence: atggagggctcaggggagcagccgggcccacaaccacagcatcccggagaccaccgcatccgcgacggcgacttcgtggtgctgaaacgtgaagatgtgtttaaagcagtacaagtccagcggagaaaaaaagtaactttcgaaaaacagtggttctacctggataacgtcattg
  • Show more
Description: A cloning plasmid for the TRMT6 gene.

DNMT3L cloning plasmid

CSB-CL891717HU-10ug 10ug
EUR 434
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1161
  • Sequence: atggcggccatcccagccctggacccagaggccgagcccagcatggacgtgattttggtgggatccagtgagctctcaagctccgtttcacccgggacaggcagagatcttattgcatatgaagtcaaggctaaccagcgaaatatagaagacatctgcatctgctgcggaagtc
  • Show more
Description: A cloning plasmid for the DNMT3L gene.

FBXO9 cloning plasmid

CSB-CL891719HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1212
  • Sequence: atgttccgagctcagtggatgtttgaacttgctccaggtgtaagctctagcaatttagaaaatcgaccttgcagagcagcaagaggctctctccagaaaacatcggcagataccaaaggaaaacaagaacaggcaaaagaagaaaaggctcgagaactcttcctaaaagcagtag
  • Show more
Description: A cloning plasmid for the FBXO9 gene.

RCAN3 cloning plasmid

CSB-CL891720HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgctgagggacactatgaaatcttggaatgatagccagtcagatctgtgtagcactgaccaagaagaggaagaagagatgatttttggtgaaaatgaagatgatttggatgagatgatggatttaagtgatctgcctacctcactttttgcttgcagcgtccatgaagcagtgtt
  • Show more
Description: A cloning plasmid for the RCAN3 gene.

FBXW11 cloning plasmid

CSB-CL891721HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1590
  • Sequence: atggagcccgactcggtgattgaggacaagaccatcgagctcatgaacacttcagttatggaagatcaaaatgaagatgagtccccaaagaaaaatactctttggcagataagtaatggaacatcatctgtgatcgtctccagaaagaggccatcagaaggaaactatcaaaaag
  • Show more
Description: A cloning plasmid for the FBXW11 gene.

CROT cloning plasmid

CSB-CL891723HU-10ug 10ug
EUR 185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 264
  • Sequence: atggaaaatcaattggctaaatcaactgaagaacgaacatttcagtaccaggattctcttccatcactgcctgttccttcacttgaagaatcattaaaaaaataccttgaatcagtgaaaccatttgcaaatcaagaagaatataagaaaactgaagaaatagttcaaaaatttca
  • Show more
Description: A cloning plasmid for the CROT gene.

VPREB3 cloning plasmid

CSB-CL891724HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atggcctgccggtgcctcagcttccttctgatggggaccttcctgtcagtttcccagacagtcctggcccagctggatgcactgctggtcttcccaggccaagtggctcaactctcctgcacgctcagcccccagcacgtcaccatcagggactacggtgtgtcctggtaccagca
  • Show more
Description: A cloning plasmid for the VPREB3 gene.

MAN1B1 cloning plasmid

CSB-CL891727HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2100
  • Sequence: atggctgcctgcgagggcaggagaagcggagctctcggttcctctcagtcggacttcctgacgccgccagtgggcggggccccttgggccgtcgccaccactgtagtcatgtacccaccgccgccgccgccgcctcatcgggacttcatctcggtgacgctgagctttggcgaga
  • Show more
Description: A cloning plasmid for the MAN1B1 gene.

MAN1B1 cloning plasmid

CSB-CL891727HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2100
  • Sequence: atggctgcctgcgagggcaggagaagcggagctctcggttcctctcagtcggacttcctgacgccgccagtgggcggggccccttgggccgtcgccaccactgtagtcatgtacccaccgccgccgccgccgcctcatcgggacttcatctcggtgacgctgagctttggcgaga
  • Show more
Description: A cloning plasmid for the MAN1B1 gene.

C14orf1 cloning plasmid

CSB-CL891729HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atgagccgtttcctgaatgtgttaagaagttggctggttatggtgtccatcatagccatggggaacacgctgcagagcttccgagaccacacttttctctatgaaaagctctacactggcaagccaaaccttgtgaatggcctccaagctcggacctttgggatctggacgctgct
  • Show more
Description: A cloning plasmid for the C14orf1 gene.

FBXW2 cloning plasmid

CSB-CL891730HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1365
  • Sequence: atggagagaaaggactttgagacatggcttgataacatttctgttacatttctttctctgacggacttgcagaaaaatgaaactctggatcacctgattagtctgagtggggcagtccagctcaggcatctctccaataacctagagactctcctcaagcgggacttcctcaaac
  • Show more
Description: A cloning plasmid for the FBXW2 gene.

EIF2C2 cloning plasmid

CSB-CL891731HU1-10ug 10ug
EUR 602
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1758
  • Sequence: atgaagaggaagtaccgtgtctgcaatgtgacccggcggcccgccagtcaccaaacattcccgctgcagcaggagagcgggcagacggtggagtgcacggtggcccagtatttcaaggacaggcacaagttggttctgcgctacccccacctcccatgtttacaagtcggacagg
  • Show more
Description: A cloning plasmid for the EIF2C2 gene.

EIF2C2 cloning plasmid

CSB-CL891731HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgcccatccagggccagccgtgcttctgcaaatacgcgcagggggcggacagcgtggagcccatgttccggcacctgaagaacacgtatgcgggcctgcagctggtggtggtcatcctgcccggcaagacgcccgtgtacgccgaggtcaagcgcgtgggagacacggtgctgg
  • Show more
Description: A cloning plasmid for the EIF2C2 gene.

ACSL5 cloning plasmid

CSB-CL891734HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2052
  • Sequence: atgctttttatctttaactttttgttttccccacttccgaccccggcgttgatctgcatcctgacatttggagctgccatcttcttgtggctgatcaccagacctcaacccgtcttacctcttcttgacctgaacaatcagtctgtgggaattgagggaggagcacggaaggggg
  • Show more
Description: A cloning plasmid for the ACSL5 gene.

SLC39A10 cloning plasmid

CSB-CL891736HU-10ug 10ug
EUR 808
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2496
  • Sequence: ATGAAGGTACATATGCACACAAAATTTTGCCTCATTTGTTTGCTGACATTTATTTTTCATCATTGCAACCATTGCCATGAAGAACATGACCATGGCCCTGAAGCGCTTCACAGACAGCATCGTGGAATGACAGAATTGGAGCCAAGCAAATTTTCAAAGCAAGCTGCTGAAAATG
  • Show more
Description: A cloning plasmid for the SLC39A10 gene.

ODF2L cloning plasmid

CSB-CL891737HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 231
  • Sequence: atgttgctagaaaatctaactgataatgaaagtgaaaatactaatcttaagaagaaggtatttgaaaaggaggcccatatccaagaactttcttgtttgtttcagagtgaaaagagcttagaaaccaagatagccaagtggaacctgcaatcaagaatgaataagaatgaggctat
  • Show more
Description: A cloning plasmid for the ODF2L gene.

GRID1 cloning plasmid

CSB-CL891738HU1-10ug 10ug
EUR 622
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1830
  • Sequence: atggaagcgctgacgctgtggcttctcccctggatatgccagtgcgtgtcggtgcgggccgactccatcatccacatcggtgccatcttcgaggagaacgcggccaaggacgacagggtgttccagttggcggtatccgacctgagcctcaacgatgacatcctgcagagcgaga
  • Show more
Description: A cloning plasmid for the GRID1 gene.

GRID1 cloning plasmid

CSB-CL891738HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 393
  • Sequence: atgaacagcctcatggatgaagacattgctcacaagcagatttccccagcgtcgattgagctctcggccctggagatggggggcctggctcccacccagaccttggagccgacacgggagtaccagaacacccagctctcggtcagcacctttctgccagagcagagcagccatgg
  • Show more
Description: A cloning plasmid for the GRID1 gene.

CA14 cloning plasmid

CSB-CL891783HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1014
  • Sequence: atgttgttctccgccctcctgctggaggtgatttggatcctggctgcagatgggggtcaacactggacgtatgagggcccacatggtcaggaccattggccagcctcttaccctgagtgtggaaacaatgcccagtcgcccatcgatattcagacagacagtgtgacatttgacc
  • Show more
Description: A cloning plasmid for the CA14 gene.

TMCO1 cloning plasmid

CSB-CL891784HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 567
  • Sequence: atgagcactatgttcgcggacactctcctcatcgtttttatctctgtgtgcacggctctgctcgcagagggcataacctgggtcctggtttacaggacagacaagtacaagagactgaaggcagaagtggaaaaacagagtaaaaaattggaaaagaagaaggaaacaataacaga
  • Show more
Description: A cloning plasmid for the TMCO1 gene.

HPCAL4 cloning plasmid

CSB-CL891785HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: atggggaagaccaacagcaagctggcccccgaggtgctggaggaccttgttcagaacactgagttcagcgagcaggagctgaagcagtggtacaagggcttcctgaaggactgccccagcggcatcctcaacctggaggagtttcagcagctctacatcaagttcttcccctacgg
  • Show more
Description: A cloning plasmid for the HPCAL4 gene.

PRPF19 cloning plasmid

CSB-CL891786HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atgtccctaatctgctccatctctaacgaagtgccggagcacccatgtgtatcccctgtctctaatcatgtttatgagcggcggctcatcgagaagtacattgcggagaatggtaccgaccccatcaacaaccagcctctctccgaggagcagctcatcgacatcaaagttgctc
  • Show more
Description: A cloning plasmid for the PRPF19 gene.

SNX12 cloning plasmid

CSB-CL891787HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgtcggacacggcagtagctgatacccggcgccttaactcgaagccgcaggacctgaccgacgcttacgggccgccaagtaacttcctggagatcgacatctttaatcctcagacggtgggcgtgggacgcgcgcgcttcaccacctatgaggttcgcatgcggacaaacctacc
  • Show more
Description: A cloning plasmid for the SNX12 gene.

SNX12 cloning plasmid

CSB-CL891787HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 489
  • Sequence: ATGTCGGACACGGCAGTAGCTGATACCCGGCGCCTTAACTCGAAGCCGCAGGACCTGACCGACGCTTACGGGCCGCCAAGTAACTTCCTGGAGATCGACATCTTTAATCCTCAGACGGTGGGCGTGGGACGCGCGCGCTTCACCACCTATGAGGTTCGCATGCGGACAAACCTACC
  • Show more
Description: A cloning plasmid for the SNX12 gene.

NDRG2 cloning plasmid

CSB-CL891788HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1074
  • Sequence: atggcggagctgcaggaggtgcagatcacagaggagaagccactgttgccaggacagacgcctgaggcggccaagactcactctgtggagacaccatacgtctctgtcactttcactgtctatggcacccccaaacccaaacgcccagcgatccttacctaccacgatgtgggac
  • Show more
Description: A cloning plasmid for the NDRG2 gene.

NDRG2 cloning plasmid

CSB-CL891788HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atggcggagctgcaggaggtgcagatcacagaggagaagccactgttgccaggacagacgcctgaggcggccaaggaggctgagttagctgcccgaatcctcctggaccagggacagactcactctgtggagacaccatacgtctctgtcactttcactgtctatggcaccccca
  • Show more
Description: A cloning plasmid for the NDRG2 gene.

PCDHB10 cloning plasmid

CSB-CL891789HU-10ug 10ug
EUR 783
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2403
  • Sequence: atggctgtcagagagttgtgcttcccaagacaaaggcaagtcctgtttctttttcttttttggggagtgtccttggcaggttctgggtttggacgttattcggtgactgaggaaacagagaaaggatcctttgtggtcaatctggcaaaggatctgggactagcagagggggagc
  • Show more
Description: A cloning plasmid for the PCDHB10 gene.

TNFSF18 cloning plasmid

CSB-CL891791HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 534
  • Sequence: atgtgtttgagccacttggaaaatatgcctttaagccattcaagaactcaaggagctcagagatcatcctggaagctgtggctcttttgctcaatagttatgttgctatttctttgctccttcagttggctaatctttatttttctccaattagagactgctaaggagccctgtat
  • Show more
Description: A cloning plasmid for the TNFSF18 gene.

ING4 cloning plasmid

CSB-CL891792HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 750
  • Sequence: atggctgcggggatgtatttggaacattatctggacagtattgaaaaccttccctttgaattacagagaaactttcagctcatgagggacctagaccaaagaacagaggacctgaaggctgaaattgacaagttggccactgagtatatgagtagtgcccgcagcctgagctccga
  • Show more
Description: A cloning plasmid for the ING4 gene.

LHX6 cloning plasmid

CSB-CL891795HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: ATGGCCCAGCCAGGGTCCGGCTGCAAAGCGACCACCCGCTGTCTTGAAGGGACCGCGCCGCCCGCCATGGCTCAGTCTGACGCCGAGGCCCTGGCAGGAGCTCTGGACAAGGACGAGGGTCAGGCCTCCCCATGTACGCCCAGCACGCCATCTGTCTGCTCACCGCCCTCTGCCG
  • Show more
Description: A cloning plasmid for the LHX6 gene.

AGTPBP1 cloning plasmid

CSB-CL891799HU-10ug 10ug
EUR 1260
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3561
  • Sequence: atgagcaagttaaaagtgataccagaaaaaagccttaccaataattctaggatcgtaggactcctggctcaactggagaagatcaatgctgagccttcagaatcagacactgcccgatatgttacatcaaaaattcttcatctggctcagagtcaagaaaaaacaaggagagaaa
  • Show more
Description: A cloning plasmid for the AGTPBP1 gene.

ICK cloning plasmid

CSB-CL891800HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atgaatagatacacaacaatcaggcagctcggggatggaacctacggttccgtcctgctgggaagaagcattgagtctggggagctgatcgctattaaaaaaatgaaaagaaaattttattcctgggaggaatgcatgaaccttcgggaggttaagtctttaaagaagctcaacca
  • Show more
Description: A cloning plasmid for the ICK gene.

CNTN6 cloning plasmid

CSB-CL891801HU-10ug 10ug
EUR 1106
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3087
  • Sequence: ATGAGGTTGCTATGGAAACTGGTAATTCTGCTGCCACTCATAAACTCTTCTGCAGGTGATGGTCTTTTAAGCCGTCCTATTTTTACTCAGGAGCCACATGATGTCATTTTTCCTTTGGATTTATCAAAATCTGAGGTCATCCTGAATTGTGCTGCTAACGGTTACCCTTCGCCTC
  • Show more
Description: A cloning plasmid for the CNTN6 gene.

Higher complete fish intake (a number of versus lower than one parts/week) was related with a considerably decrease threat of diabetes in analyses adjusted for age, intercourse, household historical past of diabetes, schooling, smoking, bodily exercise, dietary components (complete power intake, alcohol intake, and plasma vitamin C) and weight problems (BMI and waist circumference). White fish and oily fish intakes have been equally inversely related with diabetes threat, however the associations weren’t vital after adjustment for dietary components (oily fish) or weight problems (white fish). Fried fish was not considerably related with diabetes threat. Consuming a number of parts/week of shellfish was related with an elevated threat of diabetes (OR 1.36 [1.02-1.81]) in adjusted analyses.