Previous research, primarily amongst populations with excessive consumption of seafood, have advised that elevated marine n-3 polyunsaturated fatty acid (PUFA) intake throughout pregnancy promotes longer gestation and increased start weight. Few research have remoted the contribution of fetal growth to start weight. Using information from 2,109 pregnant girls in Massachusetts enrolled in Project Viva from 1999 to 2002, the authors examined associations of marine n-3 PUFA and seafood intake with start weight and birth-weight-for-gestational-age z worth (fetal growth) utilizing linear regression; length of gestation utilizing median regression; and low start weight, preterm supply, and being small for gestational age utilizing logistic regression.
After adjustment for maternal and baby components, start weight was 94 (95% confidence interval: 23, 166) g decrease and fetal growth z worth 0.19 (95% confidence interval: 0.08, 0.31) items decrease within the highest in contrast with the bottom quartile of first-trimester n-3 PUFA intake. Results for the second and third trimesters have been comparable, and findings for seafood paralleled these for n-3 PUFA. Elongated n-3 PUFA intake and seafood intake weren’t related with length of gestation or threat of preterm start. Results from this US cohort assist the conclusion that seafood intake throughout pregnancy is related with diminished fetal growth.
Lifetime prevalence charges in numerous international locations for bipolar I dysfunction, bipolar II dysfunction, bipolar spectrum dysfunction, and schizophrenia have been recognized from population-based epidemiological research that used comparable strategies. These epidemiological research used structured diagnostic interviews with comparable diagnostic standards and have been inhabitants based mostly with giant pattern sizes. Simple linear and nonlinear regression analyses have been used to check these prevalence information to variations in obvious seafood consumption, an financial measure of disappearance of seafood from the economic system.

Investigation of archaeal and bacterial range in fermented seafood utilizing barcoded pyrosequencing.

Little is understood concerning the archaeal range of fermented seafood; most of the sooner research of fermented meals have targeted on lactic acid micro organism (LAB) within the fermentation course of. In this examine, the archaeal and bacterial range in seven sorts of fermented seafood have been culture-independently examined utilizing barcoded pyrosequencing and PCR-denaturing gradient gel electrophoresis (DGGE) strategies. The multiplex barcoded pyrosequencing was carried out in a single run, with a number of samples tagged uniquely by multiplex identifiers, utilizing completely different primers for Archaea or Bacteria. Because PCR-DGGE evaluation is a standard molecular ecological strategy, this evaluation was additionally carried out on the identical samples and the results have been in contrast with the results of the barcoded pyrosequencing evaluation.
A complete of 13 372 sequences have been retrieved from 15 898 pyrosequencing reads and have been analyzed to judge the variety of the archaeal and bacterial populations in seafood. The most predominant sorts of archaea and micro organism recognized within the samples included extraordinarily halophilic archaea associated to the household Halobacteriaceae; numerous uncultured mesophilic Crenarchaeota, together with Crenarchaeota Group I.1 (CG I.1a and CG I.1b), Marine Benthic Group B (MBG-B), and Miscellaneous Crenarchaeotic Group (MCG); and LAB affiliated with genus Lactobacillus and Weissella.
Interestingly, quite a few uncultured mesophilic Crenarchaeota teams have been as ubiquitous within the fermented seafood as in terrestrial and aquatic niches; the existence of these Crenarchaeota teams has not been reported in any fermented meals. These results point out that the archaeal populations within the fermented seafood analyzed are numerous and embody the halophilic and mesophilic teams, and that barcoded pyrosequencing is a promising and cost-effective technique for analyzing microbial range in contrast with standard approaches.
 Associations of seafood and elongated n-3 fatty acid intake with fetal growth and length of gestation: results from a US pregnancy cohort.

Epidemiology of seafood-associated infections within the United States.

Seafood is a component of a healthful food plan, however seafood consumption just isn’t risk-free. Seafood is accountable for an vital proportion of food-borne diseases and outbreaks within the United States. Seafood-associated infections are brought on by a selection of micro organism, viruses, and parasites; this numerous group of pathogens results in a wide selection of medical syndromes, every with its personal epidemiology. Some seafood commodities are inherently extra dangerous than others, owing to many components, together with the character of the atmosphere from which they arrive, their mode of feeding, the season throughout which they’re harvested, and how they’re ready and served.

Prevention of seafood-associated infections requires an understanding not solely of the etiologic brokers and seafood commodities related with sickness but additionally of the mechanisms of contamination which are amenable to manage. Defining these drawback areas, which depends on surveillance of seafood-associated infections by means of outbreak and case reporting, can result in focused analysis and assist to information management efforts. Coordinated efforts are essential to additional scale back the danger of seafood-associated diseases. Continued surveillance can be vital to evaluate the effectiveness of present and future prevention methods.

T&A Cloning Vector

FYC002-20P 1 vial Ask for price

dCas9 C-terminal Cloning Vector

K014 10 ug
EUR 721

pUCM-T Cloning Vector Kit

BS435 20Preps
EUR 93.5
  • Product category: Molecular Biology Kits/Cloning/Cloning Kits (Specific)

pUCM-T Cloning Vector Kit

BS436 100preps
EUR 224
  • Product category: Molecular Biology Kits/Cloning/Cloning Kits (Specific)

gRNA- Cloning

PVT10957 2 ug
EUR 301

pcDNA3 GFP LIC cloning vector (6D)

PVT10748 2 ug
EUR 301

PUCM-T Cloning Vector (50ng/ul)

BS433 1UG
EUR 76.1
  • Product category: PCR Related/Vectors/Plasmids

PUCM-T Cloning Vector (50ng/ul)

BS434 5UG
EUR 154.4
  • Product category: PCR Related/Vectors/Plasmids

pCDF1-MCS1 cDNA Cloning and Expression Vector

CD100A-1 10 ug
EUR 544
  • Category: Lentiviral Technology

PALMD cloning plasmid

CSB-CL017416HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1656
  • Sequence: atggaagaagctgagctggtgaagggaagactccaggccatcacagataaaagaaaaatacaggaagaaatctcacagaagcgtctgaaaatagaggaagacaaactaaagcaccagcatttgaagaaaaaggccttgagggagaaatggcttctagatggaatcagcagcggaa
  • Show more
Description: A cloning plasmid for the PALMD gene.

PAM cloning plasmid

CSB-CL017417HU-10ug 10ug
EUR 838
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2601
  • Sequence: atggctggccgcgtccctagcctgctagttctccttgtttttccaagcagctgtttggctttccgaagcccactttctgtctttaagaggtttaaagaaactaccagaccattttccaatgaatgtcttggtaccaccagacccgtagttcctattgattcatcagattttgcat
  • Show more
Description: A cloning plasmid for the PAM gene.

PANK1 cloning plasmid

CSB-CL017421HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atggcagctaaaggcgacagcaccaatgttgataaactggtgaaggacatttacggaggagactatgaacgatttggccttcaaggatctgctgtagcatcaagctttggcaacatgatgagtaaagaaaagcgagattccatcagcaaggaagacctcgcccgggccacattggt
  • Show more
Description: A cloning plasmid for the PANK1 gene.

PAPLN cloning plasmid

CSB-CL017431HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 390
  • Sequence: atgcggctgctcctgctcgtgccgctgctgctggctccagcgcccgggtcctcggctcccaaggtgaggcggcagagtgacacctggggaccctggagccagtggagcccctgcagccggacctgtggagggggtgtcagcttccgggagcgcccctgctactcccagaggagaga
  • Show more
Description: A cloning plasmid for the PAPLN gene.

PAPOLA cloning plasmid

CSB-CL017432HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgccgtttccagttacaacacagggatcacaacaaacacaaccgccacagaagcactatggcattacttctcctatcagcttagcagcccccaaggagactgactgcgtacttacacagaaactaattgagacattgaaaccctttggggtttttgaagaggaagaggaactgca
  • Show more
Description: A cloning plasmid for the PAPOLA gene.

PARK2 cloning plasmid

CSB-CL017451HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: atgatagtgtttgtcaggttcaactccagccatggtttcccagtggaggtcgattctgacaccagcatcttccagctcaaggaggtggttgctaagcgacagggggttccggctgaccagttgcgtgtgattttcgcagggaaggagctgaggaatgactggactgtgcagaatt
  • Show more
Description: A cloning plasmid for the PARK2 gene.

PARN cloning plasmid

CSB-CL017456HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1920
  • Sequence: atggagataatcaggagcaattttaagagtaatcttcacaaagtgtaccaggccatagaggaggccgacttcttcgccatcgatggggagttttcaggaatcagtgatggaccttcagtctctgcattaacaaatggttttgacactccagaagagaggtatcagaagcttaaaa
  • Show more
Description: A cloning plasmid for the PARN gene.

PAX3 cloning plasmid

CSB-CL017489HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagat
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX3 cloning plasmid

CSB-CL017489HU2-10ug 10ug
EUR 517
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTACCCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGCGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX4 cloning plasmid

CSB-CL017490HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 774
  • Sequence: ATGGCCTGGTCCAGTAAGTCTTGGCTTTGTCTTATAGCCTCCTCCTGTCCCAGGGACACTCTCCTTCCTTCTGCCCATCATGCCTCACCTGTCCCTGCTTCTCACCTGACTCAGGTATCTAATGGCTGTGTGAGCAAGATCCTAGGGCGTTACTACCGCACAGGTGTCTTGGAGCC
  • Show more
Description: A cloning plasmid for the PAX4 gene.

PAX6 cloning plasmid

CSB-CL017492HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1267
  • Sequence: atgcagaacagtcacagcggagtgaatcagctcggtggtgtctttgtcaacgggcggccactgccggactccacccggcagaagattgtagagctagctcacagcggggcccggccgtgcgacatttcccgaattctgcaggtgtccaacggatgtgtgagtaaaattctgggca
  • Show more
Description: A cloning plasmid for the PAX6 gene.

PAX7 cloning plasmid

CSB-CL017493HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: ATGGCGGCCCTTCCCGGCACGGTACCGAGAATGATGCGGCCGGCTCCGGGGCAGAACTACCCCCGCACGGGATTCCCTTTGGAAGTGTCCACCCCGCTTGGCCAAGGCCGGGTCAATCAGCTGGGAGGGGTCTTCATCAATGGGCGACCCCTGCCTAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX7 gene.

PAX8 cloning plasmid

CSB-CL017494HU-10ug 10ug
EUR 489
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1353
  • Sequence: atgcctcacaactccatcagatctggccatggagggctgaaccagctgggaggggcctttgtgaatggcagacctctgccggaagtggtccgccagcgcatcgtagacctggcccaccagggtgtaaggccctgcgacatctctcgccagctccgcgtcagccatggctgcgtca
  • Show more
Description: A cloning plasmid for the PAX8 gene.

PBLD cloning plasmid

CSB-CL017501HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 867
  • Sequence: atgaagcttcctattttcatagcagatgcattcacagcaagagcatttcgtgggaatcctgctgctgtttgcctcctagaaaatgaattggatgaagacatgcatcagaaaattgcaagggagatgaacctctctgaaactgcttttatccgaaaactgcacccgacagacaactt
  • Show more
Description: A cloning plasmid for the PBLD gene.

PBX2 cloning plasmid

CSB-CL017506HU1-10ug 10ug
EUR 404
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1050
  • Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagc
  • Show more
Description: A cloning plasmid for the PBX2 gene.

PBX2 cloning plasmid

CSB-CL017506HU2-10ug 10ug
EUR 472
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1293
  • Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagc
  • Show more
Description: A cloning plasmid for the PBX2 gene.

PBX3 cloning plasmid

CSB-CL017507HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 825
  • Sequence: atgaaccttctccgagaacagagtagaacacgtcccatttctccaaaagagattgaaagaatggtgggcatcatccatcgaaaatttagttccattcagatgcagctcaaacaaagcacttgtgaagcagttatgattttaagatcaaggttccttgatgccagacggaaaaggcg
  • Show more
Description: A cloning plasmid for the PBX3 gene.

PC cloning plasmid

CSB-CL017511HU-10ug 10ug
EUR 1252
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3537
  • Sequence: atgctgaagttccgaacagtccatgggggcctgaggctcctgggaatccgccgaacctccaccgcccccgctgcctccccaaatgtccggcgcctggagtataagcccatcaagaaagtcatggtggccaacagaggtgagattgccatccgtgtgttccgggcctgcacggagc
  • Show more
Description: A cloning plasmid for the PC gene.

PCBD1 cloning plasmid

CSB-CL017514HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atggctggcaaagcacacaggctgagcgctgaggagagggaccagctgctgccaaacctgagggctgtggggtggaatgagctggaaggccgtgatgccatcttcaagcagtttcatttcaaagacttcaacagggcctttgggttcatgacaagagtggccctgcaggctgagaa
  • Show more
Description: A cloning plasmid for the PCBD1 gene.

PCBP4 cloning plasmid

CSB-CL017521HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgagcggctcggacgggggactggaggaggagccagagctcagcatcaccctcacgctgcggatgctgatgcacgggaaggaagtgggcagcatcatcgggaagaagggcgagactgtaaagcgaatccgggagcagagcagtgcccggatcaccatctccgagggctcctgcc
  • Show more
Description: A cloning plasmid for the PCBP4 gene.

PCCB cloning plasmid

CSB-CL017523HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1620
  • Sequence: atggcggcggcattacgggtggcggcggtcggggcaaggctcagcgttctggcgagcggtctccgcgccgcggtccgcagcctttgcagccaggccacctctgttaacgaacgcatcgaaaacaagcgccggaccgcgctgctgggagggggccaacgccgtattgacgcgcagc
  • Show more
Description: A cloning plasmid for the PCCB gene.

PCDH8 cloning plasmid

CSB-CL017537HU-10ug 10ug
EUR 1147
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3213
  • Sequence: atgagtcctgtgaggcgttggggcagcccctgccttttccccttgcagctcttcagcctctgctgggtgctctcagtggcccagagcaaaacagtccgatacagcaccttcgaggaggatgcccccggcacggtcatcgggaccctggccgaggacctgcacatgaaagtatcgg
  • Show more
Description: A cloning plasmid for the PCDH8 gene.

PCF11 cloning plasmid

CSB-CL017603HU-10ug 10ug
EUR 1819
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4668
  • Sequence: ATGTCAGAGCAGACGCCGGCCGAGGCCGGTGCTGCGGGGGCCCGGGAGGACGCCTGTCGGGATTATCAGTCATCGCTCGAAGACCTGACCTTCAATAGCAAGCCGCACATCAATATGCTGACCATTCTAGCCGAGGAGAACCTGCCCTTCGCCAAGGAGATCGTCTCTCTCATCG
  • Show more
Description: A cloning plasmid for the PCF11 gene.

PCGF2 cloning plasmid

CSB-CL017606HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atgcatcggactacacggatcaaaatcacagagctgaacccccacctcatgtgtgccctctgcggggggtacttcatcgacgccaccactatcgtggagtgcctgcattccttctgcaaaacctgcatcgtgcgctacctggagaccaacaaatactgccccatgtgtgacgtgc
  • Show more
Description: A cloning plasmid for the PCGF2 gene.

PCMT1 cloning plasmid

CSB-CL017618HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atggcctggaaatccggcggcgccagccactcggagctaatccacaatctccgcaaaaatggaatcatcaagacagataaagtatttgaagtgatgctggctacagaccgctcccactatgcaaaatgtaacccatacatggattctccacaatcaataggtttccaagcaacaat
  • Show more
Description: A cloning plasmid for the PCMT1 gene.

PCNA cloning plasmid

CSB-CL017621HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 786
  • Sequence: atgttcgaggcgcgcctggtccagggctccatcctcaagaaggtgttggaggcactcaaggacctcatcaacgaggcctgctgggatattagctccagcggtgtaaacctgcagagcatggactcgtcccacgtctctttggtgcagctcaccctgcggtctgagggcttcgacac
  • Show more
Description: A cloning plasmid for the PCNA gene.

PCNXL2 cloning plasmid

CSB-CL017629HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 915
  • Sequence: atgctgttttttggtggttctgctgtgtctgggataacctcggctgtttacagtgtggcccggagcgtcttggctgccgccctgctccacgcagtctgcttcagtgcagtgaaggaaccgtggagcatgcaacacatcccggcactgttttcggccttctgtggcctcttggtcgc
  • Show more
Description: A cloning plasmid for the PCNXL2 gene.

PCOLCE2 cloning plasmid

CSB-CL017632HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 831
  • Sequence: atgaggggcgcgaacgcctgggcgccactctgcctgctgctggctgccgccacccagctctcgcggcagcagtccccagagagacctgttttcacatgtggtggcattcttactggagagtctggatttattggcagtgaaggttttcctggagtgtaccctccaaatagcaaatg
  • Show more
Description: A cloning plasmid for the PCOLCE2 gene.

PCP4 cloning plasmid

CSB-CL017636HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 189
  • Sequence: atgagtgagcgacaaggtgctggggcaaccaatggaaaagacaagacatctggtgaaaatgatggacagaagaaagttcaagaagaatttgacattgacatggatgcaccagagacagaacgtgcagcggtggccattcagtctcagttcagaaaattccagaagaagaaggctgg
  • Show more
Description: A cloning plasmid for the PCP4 gene.

PCSK1 cloning plasmid

CSB-CL017640HU-10ug 10ug
EUR 742
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2262
  • Sequence: atggagcgaagagcctggagtctgcagtgcactgctttcgtcctcttttgcgcttggtgtgcactgaacagtgcaaaagcgaaaaggcaatttgtcaatgaatgggcagcggagatccccgggggcccggaagcagcctcggccatcgccgaggagctgggctatgaccttttgg
  • Show more
Description: A cloning plasmid for the PCSK1 gene.

PCSK4 cloning plasmid

CSB-CL017643HU-10ug 10ug
EUR 314
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 729
  • Sequence: atgggcacgcgctccacactcgtggccatacgacccttggacgtcagcactgaaggctacaacaactgggtcttcatgtccacccacttctgggatgagaacccacagggcgtgtggaccctgggcctagagaacaagggctactatttcaacacggggacgttgtaccgctacac
  • Show more
Description: A cloning plasmid for the PCSK4 gene.

PCSK5 cloning plasmid

CSB-CL017644HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2742
  • Sequence: atgggctgggggagccgctgctgctgcccgggacgtttggacctgctgtgcgtgctggcgctgctcgggggctgcctgctccccgtgtgtcggacgcgcgtctacaccaaccactgggcagtcaaaatcgccgggggcttcccggaggccaaccgtatcgccagcaagtacggat
  • Show more
Description: A cloning plasmid for the PCSK5 gene.

PCSK7 cloning plasmid

CSB-CL017646HU-10ug 10ug
EUR 607
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1776
  • Sequence: atgccgaaggggaggcagaaagtgccacacttggatgcccccctgggcctgcccacctgcctctggctggaattagccgggctcttcttactggttccctgggtcatgggcctggcagggacaggtgggcctgatggccagggcacaggggggccgagctgggctgtgcacctgg
  • Show more
Description: A cloning plasmid for the PCSK7 gene.

PCTP cloning plasmid

CSB-CL017651HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atggagctggccgccggaagcttctcggaggagcagttctgggaggcctgcgccgagctccagcagcccgctctggccggggccgactggcagctcctagtggagacctcgggcatcagcatctaccggctgctggacaagaagactggactttatgagtataaagtctttggtgt
  • Show more
Description: A cloning plasmid for the PCTP gene.

PCYOX1 cloning plasmid

CSB-CL017652HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atggggcgcgtcgtcgcggagcttgtctcctcgctgctggggttgtggctgttgctgtgcagctgcggatgccccgagggcgccgagctgcgtgctccgccagataaaatcgcgattattggagccggaattggtggcacttcagcagcctattacctgcggcagaaatttggga
  • Show more
Description: A cloning plasmid for the PCYOX1 gene.

PDCD1LG2 cloning plasmid

CSB-CL017667HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgatcttcctcctgctaatgttgagcctggaattgcagcttcaccagatagcagctttattcacagtgacagtccctaaggaactgtacataatagagcatggcagcaatgtgaccctggaatgcaactttgacactggaagtcatgtgaaccttggagcaataacagccagttt
  • Show more
Description: A cloning plasmid for the PDCD1LG2 gene.

PDCD5 cloning plasmid

CSB-CL017671HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaacacggggatcctggtgatgcggcccaacaggaagcaaagcacagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccgggccaggttaagtaactt
  • Show more
Description: A cloning plasmid for the PDCD5 gene.

PDCD6 cloning plasmid

CSB-CL017672HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 468
  • Sequence: atggccgcctactcttaccgccccggccctgggcctgctgcaggcgcggcgctgccggaccagagcttcctgtggaacgttttccagagggtcgataaagacaggagtggagtgatatcagacaccgagcttcagcaagctctctccaacggcacgtggactccctttaatccagt
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDCD6 cloning plasmid

CSB-CL017672HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: atggccgcctactcttaccgccccggccctggggccggccctgggcctgctgcaggcgcggcgctgccggaccagagcttcctgtggaacgttttccagagggtcgataaagacaggagtggagtgatatcagacaccgagcttcagcaagctctctccaacggcacgtggactcc
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDCD6 cloning plasmid

CSB-CL017672HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: ATGGCCGCCTACTCTTACCGCCCCGGCCCTGGGGCCGGCCCTGGGCCTGCTGCAGGCGCGGCGCTGCCGGACCAGAGCTTCCTGTGGAACGTTTTCCAGAGGGTCGATAAAGACAGGAGTGGAGTGATATCAGACACCGAGCTTCAGCAAGCTCTCTCCAACGGCACGTGGACTCC
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDGFB cloning plasmid

CSB-CL017709HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgaatcgctgctgggcgctcttcctgtctctctgctgctacctgcgtctggtcagcgccgagggggaccccattcccgaggagctttatgagatgctgagtgaccactcgatccgctcctttgatgatctccaacgcctgctgcacggagaccccggagaggaagatggggccga
  • Show more
Description: A cloning plasmid for the PDGFB gene.

PDGFRA cloning plasmid

CSB-CL017712HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atggggacttcccatccggcgttcctggtcttaggctgtcttctcacagggctgagcctaatcctctgccagctttcattaccctctatccttccaaatgaaaatgaaaaggttgtgcagctgaattcatccttttctctgagatgctttggggagagtgaagtgagctggcagta
  • Show more
Description: A cloning plasmid for the PDGFRA gene.

PDGFRB cloning plasmid

CSB-CL017713HU-10ug 10ug
EUR 1217
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3321
  • Sequence: atgcggcttccgggtgcgatgccagctctggccctcaaaggcgagctgctgttgctgtctctcctgttacttctggaaccacagatctctcagggcctggtcgtcacacccccggggccagagcttgtcctcaatgtctccagcaccttcgttctgacctgctcgggttcagctc
  • Show more
Description: A cloning plasmid for the PDGFRB gene.

PDHA1 cloning plasmid

CSB-CL017715HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgaggaagatgctcgccgccgtctcccgcgtgctgtctggcgcttctcagaagccggcaagcagagtgctggtagcatcccgtaattttgcaaatgatgctacatttgaaattaagaaatgtgaccttcaccggctggaagaaggccctcctgtcacaacagtgctcaccaggg
  • Show more
Description: A cloning plasmid for the PDHA1 gene.

PDHA2 cloning plasmid

CSB-CL017716HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: ATGCTGGCCGCCTTCATCTCCCGCGTGTTGAGGCGAGTTGCCCAGAAATCAGCTCGCAGAGTGCTGGTGGCATCCCGTAACTCCTCAAATGACGCTACATTTGAAATTAAGAAATGTGATCTTTATCTGTTGGAAGAGGGTCCCCCTGTCACTACAGTGCTCACTAGGGCGGAGG
  • Show more
Description: A cloning plasmid for the PDHA2 gene.

PDHA2 cloning plasmid

CSB-CL017716HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: ATGCTGGCCGCCTTCATCTCCCGCGTGTTGAGGCGAGTTGCCCAGAAATCAGCTCGCAGAGTGCTGGTGGCATCCCGTAACTCCTCAAATGACGCTACATTTGAAATTAAGAAATGTGATCTTTATCTGTTGGAAGAGGGTCCCCCTGTCACTACAGTGCTCACTAGGGCGGAGG
  • Show more
Description: A cloning plasmid for the PDHA2 gene.

PDHB cloning plasmid

CSB-CL017717HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1080
  • Sequence: atggcggcggtgtctggcttggtgcggagaccccttcgggaggtctccgggctgctgaagaggcgctttcactggaccgcgccggctgcgctgcaggtgacagttcgtgatgctataaatcagggtatggatgaggagctggaaagagatgagaaggtatttctgcttggagaag
  • Show more
Description: A cloning plasmid for the PDHB gene.

PDHX cloning plasmid

CSB-CL017718HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggcggcctcctggaggctgggctgtgatccgcggctgctgcgttatcttgtgggcttccctggccgccgaagcgtagggctggtgaagggggctcttgggtggtctgtaagccgcggagctaattggagatggtttcacagcacgcagtggcttcggggtgatcccattaaga
  • Show more
Description: A cloning plasmid for the PDHX gene.

PDIA3 cloning plasmid

CSB-CL017720HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgcgcctccgccgcctagcgctgttcccgggtgtggcgctgcttcttgccgcggcccgcctcgccgctgcctccgacgtgctagaactcacggacgacaacttcgagagtcgcatctccgacacgggctctgcgggcctcatgctcgtcgagttcttcgccccctggtgtggac
  • Show more
Description: A cloning plasmid for the PDIA3 gene.

PDIA3 cloning plasmid

CSB-CL017720HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgcgcctccgccgcctagcgctgttcccgggtgtggcgctgcttcttgccgcggcccgcctcgccgctgcctccgacgtgctagaactcacggacgacaacttcgagagtcgcatctccgacacgggctctgcgggcctcatgctcgtcgagttcttcgctccctggtgtggac
  • Show more
Description: A cloning plasmid for the PDIA3 gene.

PDIA4 cloning plasmid

CSB-CL017722HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1938
  • Sequence: atgaggccccggaaagccttcctgctcctgctgctcttggggctggtgcagctgctggccgtggcgggtgccgagggcccggacgaggattcttctaacagagaaaatgccattgaggatgaagaggaggaggaggaggaagatgatgatgaggaagaagacgacttggaagtta
  • Show more
Description: A cloning plasmid for the PDIA4 gene.

PDLIM1 cloning plasmid

CSB-CL017731HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 990
  • Sequence: atgaccacccagcagatagacctccagggcccggggccgtggggcttccgcctcgtgggcggcaaggacttcgagcagcctctcgccatttcccgggtcactcctggaagcaaggcggctctagctaatttatgtattggagatgtaatcacagccattgatggggaaaatactag
  • Show more
Description: A cloning plasmid for the PDLIM1 gene.

PDLIM4 cloning plasmid

CSB-CL017735HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 993
  • Sequence: atgccccattccgtgaccctgcgcgggccttcgccctggggcttccgcctggtgggcggccgggacttcagcgcgcccctcaccatctcacgggtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagcacagagct
  • Show more
Description: A cloning plasmid for the PDLIM4 gene.

PDLIM4 cloning plasmid

CSB-CL017735HU2-10ug 10ug
EUR 317
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgccccattccgtgaccctgcgcgggccttcgccctggggcttccgcctggtgggcggccgggacttcagcgcgcccctcaccatctcacgggtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagcacagagct
  • Show more
Description: A cloning plasmid for the PDLIM4 gene.

PDPK1 cloning plasmid

CSB-CL017738HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: atggccaggaccaccagccagctgtatgacgccgtgcccatccagtccagcgtggtgttatgttcctgcccatccccatcaatggtgaggacccagactgagtccagcacgccccctggcattcctggtggcagcaggcagggccccgccatggacggcactgcagccgagcctc
  • Show more
Description: A cloning plasmid for the PDPK1 gene.

PDPN cloning plasmid

CSB-CL017739HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 489
  • Sequence: atgtggaaggtgtcagctctgctcttcgttttgggaagcgcgtcgctctgggtcctggcagaaggagccagcacaggccagccagaagatgacactgagactacaggtttggaaggcggcgttgccatgccaggtgccgaagatgatgtggtgactccaggaaccagcgaagaccg
  • Show more
Description: A cloning plasmid for the PDPN gene.

PDXK cloning plasmid

CSB-CL017748HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 939
  • Sequence: atggaggaggagtgccgggtgctctccatacagagccacgtcatccgcggctacgtgggcaaccgggcggccacgttcccgctgcaggttttgggatttgagattgacgcggtgaactctgtccagttttcaaaccacacaggctatgcccactggaagggccaagtgctgaattc
  • Show more
Description: A cloning plasmid for the PDXK gene.

PDXK cloning plasmid

CSB-CL017748HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atgtccccttccatctctgacccttgcctgggacaagctttgatggggggccccagcttcaaggctgtggtgggaacagcacccccaaatgccagcctctcctttcttcccatccaccagtatactgcggggccatttctggtctttgtccaacaggaaacccatttctggtggga
  • Show more
Description: A cloning plasmid for the PDXK gene.

PDYN cloning plasmid

CSB-CL017750HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggcctggcaggggctggtcctggctgcctgcctcctcatgttcccctccaccacagcggactgcctgtcgcggtgctccttgtgtgctgtaaagacccaggatggtcccaaacctatcaatcccctgatttgctccctgcaatgccaggctgccctgctgccctctgaggaatg
  • Show more
Description: A cloning plasmid for the PDYN gene.

PEBP1 cloning plasmid

CSB-CL017766HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 564
  • Sequence: atgccggtggacctcagcaagtggtccgggcccttgagcctgcaagaagtggacgagcagccgcagcacccactgcatgtcacctacgccggggcggcggtggacgagctgggcaaagtgctgacgcccacccaggttaagaatagacccaccagcatttcgtgggatggtcttga
  • Show more
Description: A cloning plasmid for the PEBP1 gene.

PECR cloning plasmid

CSB-CL017769HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 912
  • Sequence: atggcctcctgggctaagggcaggagctacctggcgcctggtttgctgcagggccaagtggccatcgtcaccggcggggccacgggcatcggaaaagccatcgtgaaggagctcctggagctggggagtaatgtggtcattgcatcccgtaagttggagagattgaagtctgcggc
  • Show more
Description: A cloning plasmid for the PECR gene.

PEMT cloning plasmid

CSB-CL017780HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atgaagagatctgggaacccgggagccgaggtaacgaacagctcggtggcagggcctgactgctgcggaggcctcggcaatattgattttagacaggcagacttctgcgttatgacccggctgctgggctacgtggaccccctggatcccagctttgtggctgccgtcatcaccat
  • Show more
Description: A cloning plasmid for the PEMT gene.

PEMT cloning plasmid

CSB-CL017780HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atgaagagatctgggaacccgggagccgaggtaacgaacagctcggtggcagggcctgactgctgcggaggcctcggcaatattgattttagacaggcagacttctgcgttatgacccggctgctgggctacgtggaccccctggatcccagctttgtggctgctgtcatcaccat
  • Show more
Description: A cloning plasmid for the PEMT gene.

PENK cloning plasmid

CSB-CL017781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 804
  • Sequence: atggcgcggttcctgacactttgcacttggctgctgttgctcggccccgggctcctggcgaccgtgcgggccgaatgcagccaggattgcgcgacgtgcagctaccgcctagtgcgcccggccgacatcaacttcctggcttgcgtaatggaatgtgaaggtaaactgccttctct
  • Show more
Description: A cloning plasmid for the PENK gene.

PEPD cloning plasmid

CSB-CL017784HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.

PEPD cloning plasmid

CSB-CL017784HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.

PER1 cloning plasmid

CSB-CL017786HU1-10ug 10ug
EUR 591
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atgagtggccccctagaaggggctgatgggggaggggaccccaggcctggggaatcattttgtcctgggggcgtcccatcccctgggcccccacagcaccggccttgcccaggccccagcctggccgatgacaccgatgccaacagcaatggttcaagtggcaatgagtccaacg
  • Show more
Description: A cloning plasmid for the PER1 gene.

PER1 cloning plasmid

CSB-CL017786HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 885
  • Sequence: atgagtggccccctagaaggggctgatgggggaggggaccccaggcctggggaatcattttgtcctgggggcgtcccatcccctgggcccccacagcaccggccttgcccaggccccagcctggccgatgacaccgatgccaacagcaatggttcaagtggcaatgagtccaacgg
  • Show more
Description: A cloning plasmid for the PER1 gene.

PER3 cloning plasmid

CSB-CL017788HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1137
  • Sequence: atgccccgcggggaagctcctggccccgggagacggggggctaaggacgaggccctgggcgaagaatcgggggagcggtggagccccgagttccatctgcagaggaaattggcggacagcagccacagtgaacagcaagatcgaaacagagtttctgaagaacttatcatggttg
  • Show more
Description: A cloning plasmid for the PER3 gene.

PES1 cloning plasmid

CSB-CL017791HU-10ug 10ug
EUR 604
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1767
  • Sequence: atgggaggccttgagaagaagaagtatgaacgaggctcggccaccaactacatcacccggaacaaagcccggaagaagctccagctgagcttggctgactttaggcggctgtgcattctgaagggcatttatccccatgaacccaaacacaagaagaaggttaacaagggttcta
  • Show more
Description: A cloning plasmid for the PES1 gene.

PEX10 cloning plasmid

CSB-CL017794HU1-10ug 10ug
EUR 384
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttgg
  • Show more
Description: A cloning plasmid for the PEX10 gene.

PEX10 cloning plasmid

CSB-CL017794HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttg
  • Show more
Description: A cloning plasmid for the PEX10 gene.

PEX11A cloning plasmid

CSB-CL017795HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atggacgccttcacccgcttcaccaaccagacccagggccgggaccgactcttcagagccactcagtacacatgcatgttgcttagatatttgttagagcccaaagctggcaaagagaaggtggtaatgaagctcaagaaactggagtccagtgtgagcactggtcgtaaatggtt
  • Show more
Description: A cloning plasmid for the PEX11A gene.

PEX11A cloning plasmid

CSB-CL017795HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: ATGAAGTCCGCGCTTTTCACCCGCTTCACCAACCAGACCCAGGGCCGGGACCGACTCTTCAGAGCCACTCAGTACACATGCATGTTGCTTAGATATTTGTTAGAGCCCAAAGCTGGCAAAGAGAAGGTGGTAATGAAGCTCAAGAAACTGGAGTCCAGTGTGAGCACTGGTCGTAA
  • Show more
Description: A cloning plasmid for the PEX11A gene.

PEX11B cloning plasmid

CSB-CL017796HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 780
  • Sequence: atggacgcctgggtccgcttcagtgctcagagccaagcccgggagcggctgtgtagggccgcccagtatgcttgctctcttcttggccatgcgctgcagaggcatggagccagtcctgagttacagaaacagattcgacaactggagagccacctgagccttggaagaaagcttct
  • Show more
Description: A cloning plasmid for the PEX11B gene.

PEX14 cloning plasmid

CSB-CL017800HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atggcgtcctcggagcaggcagagcagccgagccagccaagctctactccaggaagtgaaaatgtgctgcctcgagagccgctgattgccacggcagtgaagtttctacagaattcccgggtccgccagagcccacttgcaaccaggagagcattcctaaagaagaaagggctga
  • Show more
Description: A cloning plasmid for the PEX14 gene.

PEX19 cloning plasmid

CSB-CL017802HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 900
  • Sequence: atggccgccgctgaggaaggctgtagtgtcggggccgaagcggacagggaattggaggagcttctggaaagtgctcttgatgatttcgataaagccaaaccctccccagcacccccttctaccaccacggcccctgatgcttcggggccccagaagagatcgccaggagacactgc
  • Show more
Description: A cloning plasmid for the PEX19 gene.

PEX3 cloning plasmid

CSB-CL017804HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: atgctgaggtctgtatggaattttctgaaacgccacaaaaagaaatgcatcttcctgggcacggtccttggaggagtatatattctggggaaatatggacagaagaaaatcagagaaatacaggaaagggaggctgcagaatacattgcccaagcacgacgacaatatcattttg
  • Show more
Description: A cloning plasmid for the PEX3 gene.

PEX5 cloning plasmid

CSB-CL017805HU-10ug 10ug
EUR 640
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1896
  • Sequence: atggcaatgcgggagctggtggaggccgaatgcgggggtgccaacccgctcatgaagctcgccgggcacttcacccaggacaaggcccttcggcaggagggattgaggcctggcccctggccccccggagccccggcctctgaggcagcctccaagcctttgggagtagcttctg
  • Show more
Description: A cloning plasmid for the PEX5 gene.

PEX7 cloning plasmid

CSB-CL017808HU1-10ug 10ug
EUR 346
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgagtgcggtgtgcggtggagcggcgcggatgctgcggacgccgggacgccacggctacgccgccgagttctccccgtacctgccgggccgcctggcctgcgccaccgcgcagcactacggcatcgcgggctgtggaaccctactaatattggatccagatgaagctgggctaag
  • Show more
Description: A cloning plasmid for the PEX7 gene.

PEX7 cloning plasmid

CSB-CL017808HU2-10ug 10ug
EUR 381
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atgagtgcggtgtgcggtggagcggcgcggatgctgcggacgccgggacgccacggctacgccgccgagttctccccgtacctgccgggccgcctggcctgcgccaccgcgcagcactacggcatcgcgggctgtggaaccctactaatattggatccagatgaagctgggctaag
  • Show more
Description: A cloning plasmid for the PEX7 gene.

PF4V1 cloning plasmid

CSB-CL017810HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atgagctccgcagccaggtcccgcctcacccgcgccacccgccaggagatgctgttcttggcgttgctgctcctgccagttgtggtcgccttcgccagagctgaagctgaagaagatggggacctgcagtgcctgtgtgtgaagaccacctcccaggtccgtcccaggcacatcac
  • Show more
Description: A cloning plasmid for the PF4V1 gene.

PFDN1 cloning plasmid

CSB-CL017812HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atggccgcccccgtggatctagagctgaagaaggccttcacagagcttcaagccaaagttattgacactcaacagaaggtgaagctcgcagacatacagattgaacagctaaacagaacgaaaaagcatgcacatcttacagatacagagatcatgactttggtagatgagactaa
  • Show more
Description: A cloning plasmid for the PFDN1 gene.

PFDN2 cloning plasmid

CSB-CL017813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcggagaacagcggtcgcgccggcaagagcagcgggagcggcgcggggaagggggcggtgtccgcagagcaggtgattgctggcttcaaccgccttcggcaggaacagcgaggcctggcatccaaagcagctgagttggagatggagttgaatgagcacagcctagtgatcga
  • Show more
Description: A cloning plasmid for the PFDN2 gene.

PFDN4 cloning plasmid

CSB-CL017814HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: atggcggccaccatgaagaaggcggctgcagaagatgtcaatgttactttcgaagatcaacaaaagataaacaaatttgcacggaatacaagtagaatcacagagctgaaggaagaaatagaagtaaaaaagaaacaactccaaaacctagaagatgcttgtgatgacatcatgct
  • Show more
Description: A cloning plasmid for the PFDN4 gene.

PFDN5 cloning plasmid

CSB-CL017815HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcgcagtctattaacatcacggagctgaatctgccgcagctagaaatgctcaagaaccagctggaccaggaagtggagttcttgtccacgtccattgctcagctcaaagtggtacagaccaagtatgtggaagccaaggactgtctgaacgtgctgaacaagagcaacgaggg
  • Show more
Description: A cloning plasmid for the PFDN5 gene.

PFKFB1 cloning plasmid

CSB-CL017817HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1416
  • Sequence: ATGTCTCCAGAGATGGGAGAGCTCACCCAAACCAGGTTGCAGAAGATCTGGATTCCACACAGCAGCGGCAGCAGCAGGCTGCAACGGAGAAGGGGCTCATCCATACCCCAGTTTACCAATTCCCCCACAATGGTGATCATGGTGGGTTTACCAGCTCGAGGCAAGACCTATATCT
  • Show more
Description: A cloning plasmid for the PFKFB1 gene.

PFKL cloning plasmid

CSB-CL017821HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atggccgcggtggacctggagaagctgcgggcgtcgggcgcgggcaaggccatcggcgtcctgaccagcggcggcgacgcgcaaggcatgaacgctgctgtccgggctgtgacgcgcatgggcatttatgtgggtgccaaagtcttcctcatctacgagggctatgagggcctcg
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atggccgcggtggacctggagaagctgcgggcgtcgggcgcgggcaaggccatcggcgtcctgaccagcggcggcgacgcgcaaggcatgaacgctgctgtccgggctgtgacgcgcatgggcatttatgtgggtgccaaagtcttcctcatctacgagggctatgagggcctcg
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU3-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2484
  • Sequence: atgtgtaaccagggtagaggtcgagagtcctctcgtgggggtctccatgttcaagggagctgccgaggcttgagcaggagcccccagcaggaaactggctttgccaaggcccccgctgggacagactgtttctttcactgcagtcctgggagccgagggcaaggggacaggaaag
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU4-10ug 10ug
EUR 502
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atgggcatggaggcggtgatggcgctgctggaagccacgcctgacacgccggcctgcgtggtcaccctctcggggaaccagtcagtgcggctgcccctcatggagtgcgtgcagatgaccaaggaagtgcagaaagccatggatgacaagaggtttgacgaggccacccagctcc
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKM cloning plasmid

CSB-CL017822HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atgacccatgaagagcaccatgcagccaaaaccctggggattggcaaagccattgctgtcttaacctctggtggagatgcccaaggtatgaatgctgctgtcagggctgtggttcgagttggtatcttcaccggtgcccgtgtcttctttgtccatgagggttatcaaggcctgg
  • Show more
Description: A cloning plasmid for the PFKM gene.

PFKM cloning plasmid

CSB-CL017822HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atgacccatgaagagcaccatgcagccaaaaccctggggattggcaaagccattgctgtcttaacctctggtggagatgcccaaggtatgaatgctgctgtcagggctgtggttcgagttggtatcttcaccggtgcccgtgtcttctttgtccatgagggttatcaaggcctgg
  • Show more
Description: A cloning plasmid for the PFKM gene.

PFN1 cloning plasmid

CSB-CL017824HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atggccgggtggaacgcctacatcgacaacctcatggcggacgggacctgtcaggacgcggccatcgtgggctacaaggactcgccctccgtctgggccgccgtccccgggaaaacgttcgtcaacatcacgccagctgaggtgggtgtcctggttggcaaagaccggtcaagttt
  • Show more
Description: A cloning plasmid for the PFN1 gene.

PFN2 cloning plasmid

CSB-CL017825HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atggccggttggcagagctacgtggataacctgatgtgcgatggctgctgccaggaggccgccattgtcggctactgcgacgccaaatacgtctgggcagccacggcagggggcgtctttcagagcattacgccaatagaaatagatatgattgtaggaaaagaccgggaaggttt
  • Show more
Description: A cloning plasmid for the PFN2 gene.

PGAM2 cloning plasmid

CSB-CL017835HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atggccactcaccgcctcgtgatggtccggcacggcgagagcacatggaaccaggagaaccgtttctgtggctggttcgatgcagagctgagtgaaaaggggaccgaggaggccaagcggggagccaaggccatcaaggatgccaagatggagtttgacatctgctacacgtcagt
  • Show more
Description: A cloning plasmid for the PGAM2 gene.

PGC cloning plasmid

CSB-CL017849HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atgaagtggatggtggtggtcttggtctgcctccagctcttggaggcagcagtggtcaaagtgcccctgaagaaatttaagtctatccgtgagaccatgaaggagaagggcttgctgggggagttcctgaggacccacaagtatgatcctgcttggaagtaccgctttggtgacct
  • Show more
Description: A cloning plasmid for the PGC gene.

PGD cloning plasmid

CSB-CL017850HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1452
  • Sequence: atggcccaagctgacatcgcgctgatcggattggccgtcatgggccagaacttaattctgaacatgaatgaccacggctttgtggtctgtgcttttaataggactgtctccaaagttgatgatttcttggccaatgaggcaaagggaaccaaagtggtgggtgcccagtccctga
  • Show more
Description: A cloning plasmid for the PGD gene.

PGF cloning plasmid

CSB-CL017854HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atgccggtcatgaggctgttcccttgcttcctgcagctcctggccgggctggcgctgcctgctgtgcccccccagcagtgggccttgtctgctgggaacggctcgtcagaggtggaagtggtacccttccaggaagtgtggggccgcagctactgccgggcgctggagaggctggt
  • Show more
Description: A cloning plasmid for the PGF gene.

PGK1 cloning plasmid

CSB-CL017856HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atgtcgctttctaacaagctgacgctggacaagctggacgttaaagggaagcgggtcgttatgagagtcgacttcaatgttcctatgaagaacaaccagataacaaacaaccagaggattaaggctgctgtcccaagcatcaaattctgcttggacaatggagccaagtcggtag
  • Show more
Description: A cloning plasmid for the PGK1 gene.

PGK2 cloning plasmid

CSB-CL017859HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atgtctctttctaagaagttgactttagacaaactggatgttagagggaagcgagtcatcatgagagtagacttcaatgttcccatgaagaagaaccagattacaaacaaccagaggatcaaggcttccatcccaagcatcaagtactgcctggacaatggagccaaggcagtag
  • Show more
Description: A cloning plasmid for the PGK2 gene.

PGLS cloning plasmid

CSB-CL017861HU1-10ug 10ug
EUR 279
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 603
  • Sequence: atggccgcgccggccccgggcctcatctcggtgttctcgagttcccaggagctgggtgcggcgctagcgcagctggtggcccagcgcgcagcatgctgcctggcaggggcccgcgcccgtttcgcgctcggcctgtcgggcgggagcctcgtctcgatgctagcccgcgagctacc
  • Show more
Description: A cloning plasmid for the PGLS gene.

PGLS cloning plasmid

CSB-CL017861HU2-10ug 10ug
EUR 327
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 777
  • Sequence: atggccgcgccggccccgggcctcatctcggtgttctcgagttcccaggagctgggtgcggcgctagcgcagctggtggcccagcgcgcagcatgctgcctggcaggggcccgcgcccgtttcgcgctcggcttgtcgggcgggagcctcgtctcgatgctagcccgcgagctacc
  • Show more
Description: A cloning plasmid for the PGLS gene.

PGLYRP3 cloning plasmid

CSB-CL017864HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1026
  • Sequence: atggggacgctgccatggcttcttgccttcttcattctgggtctccaggcttgggatactcccaccatcgtctcccgcaaggagtggggggcaagaccgctcgcctgcagggccctgctgaccctgcctgtggcctacatcatcacagaccagctcccagggatgcagtgccagc
  • Show more
Description: A cloning plasmid for the PGLYRP3 gene.

PGLYRP3 cloning plasmid

CSB-CL017864HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1026
  • Sequence: atggggacgctgccatggcttcttgccttcttcattctgggtctccaggcttgggatactcccaccatcgtctcccgcaaggagtggggggcaagaccgctcgcctgcagggccctgctgaccctgcctgtggcctacatcatcacagaccagctcccagggatgcagtgccagc
  • Show more
Description: A cloning plasmid for the PGLYRP3 gene.

PGLYRP4 cloning plasmid

CSB-CL017865HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: ATGCTGCCGTGGCTTCTTGTCTTCTCTGCTCTGGGTCTCCAGGCCTGGGGTGATTCCTCCTGGAACAAAACACAAGCTAAACAGGTATCAGAGGGGCTCCAGTACCTATTTGAGAACATCTCCCAGCTCACTGAAAAAGGCCTTCCCACAGATGTCTCCACCACGGTCTCTCGCA
  • Show more
Description: A cloning plasmid for the PGLYRP4 gene.

PGM1 cloning plasmid

CSB-CL017866HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1689
  • Sequence: atggtgaagatcgtgacagttaagacccaggcgtaccaggaccagaagccgggcacgagcgggctgcggaagcgggtgaaggtgttccagagcagcgccaactacgcggagaacttcatccagagtatcatctccaccgtggagccggcgcagcggcaggaggccacgctggtgg
  • Show more
Description: A cloning plasmid for the PGM1 gene.

PGM1 cloning plasmid

CSB-CL017866HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1689
  • Sequence: ATGGTGAAGATCGTGACAGTTAAGACCCAGGCGTACCAGGACCAGAAGCCGGGCACGAGCGGGCTGCGGAAGCGGGTGAAGGTGTTCCAGAGCAGCGCCAACTACGCGGAGAACTTCATCCAGAGTATCATCTCCACCGTGGAGCCGGCGCAGCGGCAGGAGGCCACGCTGGTGG
  • Show more
Description: A cloning plasmid for the PGM1 gene.

PGM3 cloning plasmid

CSB-CL017869HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1629
  • Sequence: atggatttaggtgctattacaaaatactcagcattacacgccaagcccaatggactgatccttcaatacgggactgctggatttcgaacgaaggcagaacatcttgatcatgtcatgtttcgcatgggattattagctgtcctgaggtcaaaacagacaaaatccactataggag
  • Show more
Description: A cloning plasmid for the PGM3 gene.

PGRMC1 cloning plasmid

CSB-CL017876HU-10ug 10ug
EUR 275
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggctgccgaggatgtggtggcgactggcgccgacccaagcgatctggagagcggcgggctgctgcatgagattttcacgtcgccgctcaacctgctgctgcttggcctctgcatcttcctgctctacaagatcgtgcgcggggaccagccggcggccagcggcgacagcgacga
  • Show more
Description: A cloning plasmid for the PGRMC1 gene.

PGRMC2 cloning plasmid

CSB-CL017877HU-10ug 10ug
EUR 297
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atggcggctggtgatggggacgtgaagctaggcaccctggggagtggcagcgagagcagcaacgacggcggcagcgagagtccaggcgacgcgggagcggcagcggaagggggaggctgggcggcggcggcgttggcgcttctgacggggggcggggaaatgctgctgaacgtggc
  • Show more
Description: A cloning plasmid for the PGRMC2 gene.

PHACTR3 cloning plasmid

CSB-CL017882HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1680
  • Sequence: atggccgcgtcggaggacgggagcggctgcctcgtgtcgcggggccgctcgcagagtgaccccagcgtcctcaccgactcctcggccacctcctccgcggacgccggggagaacccagatgagatggaccaaacgcccccggcgcgtcctgaatatctggtctcagggattcgaa
  • Show more
Description: A cloning plasmid for the PHACTR3 gene.

PHACTR4 cloning plasmid

CSB-CL017883HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2109
  • Sequence: atggaagatccatttgaggaagcagaccagcccactacagagccaggcatggtcctggacagtgtggaagcaggagacacaacacctcctaccaaaaggaagagcaagttctcaggctttggcaagatcttcaagccctggaaatggaggaaaaaaaaaagtagtgataaattta
  • Show more
Description: A cloning plasmid for the PHACTR4 gene.

PHACTR4 cloning plasmid

CSB-CL017883HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggtcctggacagtgtggaagcaggagacacaacacctcctaccaaaaggaagagcaagttctcaggctttggcaagatcttcaagccctggaaatggaggaaaaaaaaaagtagtgataaatttaaagagacttcagaagttttagaacggaaaatatctatgcgaaagccaa
  • Show more
Description: A cloning plasmid for the PHACTR4 gene.

PHB cloning plasmid

CSB-CL017885HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atggctgccaaagtgtttgagtccattggcaagtttggcctggccttagctgttgcaggaggcgtggtgaactctgccttatataatgtggatgctgggcacagagctgtcatctttgaccgattccgtggagtgcaggacattgtggtaggggaagggactcattttctcatccc
  • Show more
Description: A cloning plasmid for the PHB gene.

PHC1 cloning plasmid

CSB-CL017891HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgccaggtacagtgcagtctggtcaggcccatttggcctcctcgccaccttcatcccaggctcctggtgcactgcaggagtgccctcccacattggcccctgggatgacccttgctcctgtgcaggggacagcacatgtggtaaagggtggggctaccacctcctcacctgttg
  • Show more
Description: A cloning plasmid for the PHC1 gene.

PHF1 cloning plasmid

CSB-CL017897HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atggcgcagcccccccggctgagccgctctggtgcctcctcactttgggacccagcttctcctgctcccacctctggccccaggcctcggctttgggagggtcaagatgtgctggccagatggactgatgggctgctatacttgggtaccatcaaaaaggtggacagtgctaggg
  • Show more
Description: A cloning plasmid for the PHF1 gene.

PHF10 cloning plasmid

CSB-CL017898HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atgcttcaagaacaagtcagtgaatatttgggtgtgacctcctttaaaaggaaatatccagagcgacgagatttgtctcacaaggagaaactctacctgagagagctaaatgtcattactgaaactcagtgcactctaggcttaacagcattgcgcagtgatgaagtgattgatt
  • Show more
Description: A cloning plasmid for the PHF10 gene.

PHF11 cloning plasmid

CSB-CL017900HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atggaaaaaaggacatgtgcactctgccccaaagatgtcgaatataatgtcctgtactttgcacaatcagagaatatagctgctcatgagaattgtttgctgtattcttcaggacttgtggaatgtgaggatcaggatccacttaatcctgatagaagttttgatgtggaatcagt
  • Show more
Description: A cloning plasmid for the PHF11 gene.

PHF12 cloning plasmid

CSB-CL017901HU-10ug 10ug
EUR 702
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2115
  • Sequence: ATGTGGGAGAAAATGGAGACCAAGACGATCGTGTACGACTTGGACACATCAGGGGGGCTGATGGAGCAAATCCAAGCTCTGCTGGCTCCCCCCAAGACGGACGAGGCAGAAAAGCGCAGTCGGAAGCCTGAGAAGGAGCCCCGGAGAAGCGGCAGGGCCACCAACCACGACAGCT
  • Show more
Description: A cloning plasmid for the PHF12 gene.

PHF13 cloning plasmid

CSB-CL017902HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 903
  • Sequence: atggactctgactcttgcgccgccgccttccacccggaggaatactcccccagttgcgagaggcgcaggaccgtggaagacttcaacaaattctgcacctttgtcttggcctatgctggctacatcccttatccgaaggaggaactccctttaaggagcagccccagccctgctaa
  • Show more
Description: A cloning plasmid for the PHF13 gene.

PHF19 cloning plasmid

CSB-CL017907HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggagaatcgagctctggatccagggactcgggactcctatggtgccaccagccacctccccaacaagggggccctggcgaaggtcaagaacaacttcaaagacttgatgtccaaactgacggagggccagtatgtgctgtgccggtggacagatggcctgtactacctcgggaa
  • Show more
Description: A cloning plasmid for the PHF19 gene.

PHF19 cloning plasmid

CSB-CL017907HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1743
  • Sequence: ATGGAGAATCGAGCTCTGGATCCAGGGACTCGGGACTCCTATGGTGCCACCAGCCACCTCCCCAACAAGGGGGCCCTGGCGAAGGTCAAGAACAACTTCAAAGACTTGATGTCCAAACTGACGGAGGGCCAGTATGTGCTGTGCCGGTGGACAGATGGCCTGTACTACCTCGGGA
  • Show more
Description: A cloning plasmid for the PHF19 gene.

PHF20L1 cloning plasmid

CSB-CL017910HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgagtaaaaagcccccaaatcgccctggaatcacttttgagattggtgctcgtttggaggcactggactacttacaaaaatggtatccatcacgaattgaaaaaattgactatgaggagggcaagatgttggtccattttgagcgctggagtcatcgttatgatgagtggattta
  • Show more
Description: A cloning plasmid for the PHF20L1 gene.

PHF20L1 cloning plasmid

CSB-CL017910HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atgatccagtgtgaagagtgcttgtgttggcaacacagcgtgtgcatggggctgctggaggagagcattccagagcagtacatctgctatatctgccgggacccaccaggtcagaggtggagtgcaaaatatcgttatgataaggagtggttgaataatgggagaatgtgcgggtt
  • Show more
Description: A cloning plasmid for the PHF20L1 gene.

Higher complete fish intake (a number of versus lower than one parts/week) was related with a considerably decrease threat of diabetes in analyses adjusted for age, intercourse, household historical past of diabetes, schooling, smoking, bodily exercise, dietary components (complete power intake, alcohol intake, and plasma vitamin C) and weight problems (BMI and waist circumference). White fish and oily fish intakes have been equally inversely related with diabetes threat, however the associations weren’t vital after adjustment for dietary components (oily fish) or weight problems (white fish). Fried fish was not considerably related with diabetes threat. Consuming a number of parts/week of shellfish was related with an elevated threat of diabetes (OR 1.36 [1.02-1.81]) in adjusted analyses.